|
miRBase |
|
Stem-loop sequence hsa-mir-518f |
|||||
| Accession | MI0003154 | ||||
| Symbol | HGNC:MIR518F | ||||
| Description | Homo sapiens miR-518f stem-loop | ||||
| Gene family | MIPF0000020; mir-515 | ||||
| Stem-loop |
ugcu c a --- gu ucuca guga ccucuagagggaagc cuuuc ucuu c ||||| |||| ||||||||||||||| ||||| |||| agagu cauu ggagauuucucuucg gaaag agaa u uucu a c aaa aa |
||||
| Deep sequencing |
| ||||
| Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations. |
||||
| Genome context |
|
||||
| Clustered miRNAs | |||||
| Database links | |||||
Mature sequence hsa-miR-518f-5p |
|
| Accession | MIMAT0002841 |
| Previous IDs | hsa-miR-518f* |
| Sequence |
16 - cucuagagggaagcacuuucuc - 37 |
| Deep sequencing | 12 reads, 3 experiments |
| Evidence | experimental; array-cloned [1], cloned [2] |
| Predicted targets |
|
Mature sequence hsa-miR-518f-3p |
|
| Accession | MIMAT0002842 |
| Previous IDs | hsa-miR-518f |
| Sequence |
53 - gaaagcgcuucucuuuagagg - 73 |
| Deep sequencing | 6 reads, 4 experiments |
| Evidence | experimental; array-cloned [1], cloned [2] |
| Predicted targets |
|
References |
|
| 1 |
PMID:15965474
"Identification of hundreds of conserved and nonconserved human microRNAs"
Nat Genet. 37:766-770(2005).
|
| 2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|