|
miRBase |
|
Stem-loop sequence hsa-mir-515-1 |
|||||
| Accession | MI0003144 | ||||
| Symbol | HGNC:MIR515-1 | ||||
| Description | Homo sapiens miR-515-1 stem-loop | ||||
| Gene family | MIPF0000020; mir-515 | ||||
| Stem-loop |
u c u a uu gu ucuca gcagu au cuccaaaagaa gcac ucuguu c ||||| ||||| || ||||||||||| |||| |||||| u agagu uguca ug gagguuuucuu cgug agacga g u u c c -- aa |
||||
| Deep sequencing |
| ||||
| Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. |
||||
| Genome context |
|
||||
| Clustered miRNAs | |||||
| Database links | |||||
Mature sequence hsa-miR-515-5p |
|
| Accession | MIMAT0002826 |
| Sequence |
14 - uucuccaaaagaaagcacuuucug - 37 |
| Deep sequencing | 4 reads, 1 experiments |
| Evidence | experimental; array-cloned [1], cloned [2] |
| Predicted targets |
|
Mature sequence hsa-miR-515-3p |
|
| Accession | MIMAT0002827 |
| Sequence |
51 - gagugccuucuuuuggagcguu - 72 |
| Evidence | experimental; array-cloned [1], cloned [2] |
| Validated targets |
|
| Predicted targets |
|
References |
|
| 1 |
PMID:15965474
"Identification of hundreds of conserved and nonconserved human microRNAs"
Nat Genet. 37:766-770(2005).
|
| 2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|