Stem-loop sequence hsa-mir-492

Accession

MI0003131

Symbol

HGNC:MIR492

Description

Homo sapiens miR-492 stem-loop

Gene family

MIPF0000499; mir-492

Stem-loop

caa  a      cuacuacag  c   c ag  c           gau        ccacc 
   cu cagcca         ga cau g  ga cugcgggacaa   ucuuggug     a
   || ||||||         || ||| |  || |||||||||||   ||||||||     u
   ga gucggu         cu gua c  cu gacguccuguu   aggaccgc     u
gua  c      ------caa  c   a aa  a           ---        aagag 

Deep sequencing

2 reads, 1 experiments

Genome context

• Coordinates (GRCh37.p5): chr12: 95228174-95228289 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000410052 ; RP11-3K15.1-001; exon 1

  OTTHUMT00000410053 ; RP11-3K15.1-002; exon 1

  OTTHUMT00000410052 ; RP11-3K15.1-001; exon 1

  OTTHUMT00000410053 ; RP11-3K15.1-002; exon 1

  OTTHUMT00000410052 ; RP11-3K15.1-001; exon 1

  OTTHUMT00000410053 ; RP11-3K15.1-002; exon 1

  ENST00000557173 ; RP11-3K15.1-001; exon 1

  ENST00000405395 ; RP11-3K15.1-002; exon 1

  ENST00000557173 ; KRT19P2-001; exon 1

  ENST00000405395 ; KRT19P2-002; exon 1

  ENST00000557173 ; KRT19P2-001; exon 1

  ENST00000405395 ; KRT19P2-002; exon 1

Database links

• ENTREZGENE: 574449;MIR492
• HGNC: 32081;MIR492

Mature sequence hsa-miR-492

• Accession: MIMAT0002812
• Sequence: 30 - aggaccugcgggacaagauucuu - 52
• Deep sequencing: 1 reads, 1 experiments
• Evidence: experimental; array-cloned [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-492
  • MICRORNA.ORG:hsa-miR-492
  • MIRDB:hsa-miR-492
  • RNA22-HSA:hsa-miR-492
  • TARGETMINER:hsa-miR-492
  • TARGETSCAN-VERT:hsa-miR-492

References

1. PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).