Stem-loop sequence dre-mir-27c

AccessionMI0001930 (change log)
Previous IDsdre-mir-27c
DescriptionDanio rerio miR-27c stem-loop
Gene family MIPF0000036; mir-27
Literature search

7 open access papers mention dre-mir-27c
(19 sentences)

Stem-loop
       gugu    u            c   u       a  cauc 
5' gguu    ggug caggacuuaacc acu gugaaca ug    g
   ||||    |||| |||||||||||| ||| ||||||| ||     
3' ccag    ccgc gucuugaauugg uga cacuugu ac    a
       aucc    c            -   -       a  uuca 
Get sequence
Deep sequencing
185501 reads, 1.15e+04 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr3: 13406451-13406538 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-27c
dre-mir-23a-2chr3: 13406226-13406323 [+]
dre-mir-27cchr3: 13406451-13406538 [+]
dre-mir-24-2chr3: 13412979-13413060 [+]
Database links

Mature sequence dre-miR-27c-5p

Accession MIMAT0003401
Previous IDsdre-miR-27c*
Sequence

19 - 

cuuaacccacuugugaacaaug

 - 40

Get sequence
Deep sequencing7184 reads, 9 experiments
Evidence experimental; cloned [1]
Database links

Mature sequence dre-miR-27c-3p

Accession MIMAT0001798
Previous IDsdre-miR-27c
Sequence

56 - 

uucacagugguuaaguucugc

 - 76

Get sequence
Deep sequencing178212 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).