Stem-loop sequence hsa-mir-423

Accession

MI0001445

Symbol

HGNC:MIR423

Description

Homo sapiens miR-423 stem-loop

Gene family

MIPF0000329; mir-423

Stem-loop

-----auaa       u            -ag   g    a     cua 
         aggaagu aggcugaggggc   aga cgag cuuuu   u
         ||||||| ||||||||||||   ||| |||| |||||   u
         uccuucg ucugacuccccg   ucu gcuc gaaaa   u
cgcgcccaa       u            gag   g    -     ccu 

Deep sequencing

378213 reads, 46 experiments

Comments

miR-423 (renamed miR-423-3p here) is expressed in human promyelocytic leukemia (HL-60) cells [1]. The level of expression was shown to be up-regulated 48 hours after TPA-induction. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context

• Coordinates (GRCh37.p5): chr17: 28444097-28444190 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000256121 ; CCDC55-001; intron 1

  OTTHUMT00000256122 ; CCDC55-002; intron 1

  OTTHUMT00000256123 ; CCDC55-003; intron 1

  OTTHUMT00000256121 ; CCDC55-001; intron 1

  OTTHUMT00000256122 ; CCDC55-002; intron 1

  OTTHUMT00000256123 ; CCDC55-003; intron 1

  OTTHUMT00000256124 ; CCDC55-004; exon 1

  OTTHUMT00000447916 ; NSRP1-006; intron 1

  OTTHUMT00000256121 ; NSRP1-001; intron 1

  OTTHUMT00000256123 ; NSRP1-003; intron 1

  OTTHUMT00000447917 ; NSRP1-010; intron 1

  OTTHUMT00000447918 ; NSRP1-005; intron 1

  OTTHUMT00000447919 ; NSRP1-007; intron 1

  OTTHUMT00000256122 ; NSRP1-002; intron 1

  OTTHUMT00000447920 ; NSRP1-013; intron 1

  OTTHUMT00000447921 ; NSRP1-012; intron 1

  OTTHUMT00000447922 ; NSRP1-009; exon 1

  OTTHUMT00000256124 ; NSRP1-004; intron 2

  ENST00000247026 ; NSRP1-001; intron 1

  ENST00000475652 ; NSRP1-002; intron 1

  ENST00000479218 ; NSRP1-003; intron 1

  ENST00000540900 ; NSRP1-202; intron 1

  ENST00000247026 ; NSRP1-001; intron 1

  ENST00000475652 ; NSRP1-002; intron 1

  ENST00000479218 ; NSRP1-003; intron 1

  ENST00000467446 ; NSRP1-004; exon 1

  ENST00000540900 ; NSRP1-202; intron 1

  ENST00000584423 ; NSRP1-006; intron 1

  ENST00000247026 ; NSRP1-001; intron 1

  ENST00000540900 ; NSRP1-003; intron 1

  ENST00000584154 ; NSRP1-010; intron 1

  ENST00000394826 ; NSRP1-005; intron 1

  ENST00000479218 ; NSRP1-007; intron 1

  ENST00000475652 ; NSRP1-002; intron 1

  ENST00000584317 ; NSRP1-013; intron 1

  ENST00000583301 ; NSRP1-012; intron 1

  ENST00000467446 ; NSRP1-009; exon 1

  ENST00000577289 ; NSRP1-004; intron 2

  antisense

  OTTHUMT00000447933 ; RP11-1148O4.2-001; intron 1

  ENST00000582938 ; RP11-1148O4.2-001; intron 1

Clustered miRNAs

< 10kb from hsa-mir-423

• hsa-mir-423: chr17: 28444097-28444190 [+]
• hsa-mir-3184: chr17: 28444104-28444178 [-]

Database links

• EMBL: AY882274;AY882274
• ENTREZGENE: 494335;MIR423
• HGNC: 31880;MIR423

Mature sequence hsa-miR-423-5p

• Accession: MIMAT0004748
• Sequence: 17 - ugaggggcagagagcgagacuuu - 39
• Deep sequencing: 357684 reads, 33 experiments
• Evidence: experimental; cloned [2-4], Northern [4], Solexa [5]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-423-5p
  • MICRORNA.ORG:hsa-miR-423-5p
  • MIRDB:hsa-miR-423-5p
  • RNA22-HSA:hsa-miR-423-5p
  • TARGETMINER:hsa-miR-423-5p
  • TARGETSCAN-VERT:hsa-miR-423-5p

Mature sequence hsa-miR-423-3p

• Accession: MIMAT0001340
• Previous IDs: hsa-miR-423
• Sequence: 53 - agcucggucugaggccccucagu - 75
• Deep sequencing: 20528 reads, 31 experiments
• Evidence: experimental; cloned [1-2], Northern [1]
• Validated targets:
  • MIRTARBASE:hsa-miR-423-3p
  • TARBASE:hsa-miR-423-3p
• Predicted targets:
  • DIANA-MICROT:hsa-miR-423-3p
  • MICRORNA.ORG:hsa-miR-423-3p
  • MIRDB:hsa-miR-423-3p
  • RNA22-HSA:hsa-miR-423-3p
  • TARGETMINER:hsa-miR-423-3p
  • TARGETSCAN-VERT:hsa-miR-423-3p

References

1. PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
4. PMID:18230126 "New miRNAs cloned from neuroblastoma" Afanasyeva EA, Hotz-Wagenblatt A, Glatting KH, Westermann F BMC Genomics. 9:52(2008).
5. PMID:20158877 "Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha" Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V BMC Genomics. 11 Suppl 1:S6(2010).