Stem-loop sequence rno-mir-126a

Accession MI0000898
Previous IDs rno-mir-126
Description Rattus norvegicus miR-126a stem-loop
Gene family MIPF0000115; mir-126
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-126. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-126 is a short non-coding RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several pre- and post-transcription mechanisms. mir-126 is a human microRNA that is expressed only in endothelial cells, throughout capillaries as well as larger blood vessels, and acts upon various transcripts to control angiogenesis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
u   a  a           u       c cug   c 
 gac gc cauuauuacuu ugguacg g   uga a
 ||| || ||||||||||| ||||||| |   |||  
 cug ug guaauaaugag gccaugc c   acu c
a   g  c           u       u -aa   u 
Get sequence
Genome context
Coordinates (RGSC3.4) Overlapping transcripts
3: 4768117-4768189 [+]
sense
ENSRNOT00000026318 ; EGFL7_RAT; intron 7
ENSRNOT00000026318 ; EGFL7_RAT; intron 7
ENSRNOT00000026318 ; EGFL7_RAT; intron 7
Clustered miRNAs
< 10kb from rno-mir-126a
rno-mir-126b 3: 4768093-4768210 [-]
rno-mir-126a 3: 4768117-4768189 [+]
Database links

Mature sequence rno-miR-126a-5p

Accession MIMAT0000831
Previous IDs rno-miR-126*
Sequence

9 - 

cauuauuacuuuugguacgcg

 - 29

Get sequence
Evidence experimental; cloned [1-2], SOLiD [3]
Validated targets
Predicted targets

Mature sequence rno-miR-126a-3p

Accession MIMAT0000832
Previous IDs rno-miR-126
Sequence

46 - 

ucguaccgugaguaauaaugcg

 - 67

Get sequence
Evidence experimental; cloned [1-2], SOLiD [3]
Validated targets
Predicted targets

References

1
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).