Stem-loop sequence rno-mir-26a

Accession MI0000857
Description Rattus norvegicus miR-26a stem-loop
Gene family MIPF0000043; mir-26
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-26_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
a     -   g      u         c          g gca g 
 aggcc gug ccuugu caaguaauc aggauaggcu u   g u
 ||||| ||| |||||| ||||||||| |||||||||| |   |  
 uccgg cgc ggggca guucauugg ucuuauccgg g   c c
g     g   a      c         u          g -aa c 
Get sequence
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (RGSC3.4) Overlapping transcripts
8: 123981620-123981709 [+]
sense
ENSRNOT00000045368 ; Ctdspl; intron 4
ENSRNOT00000045368 ; Ctdspl; intron 4
ENSRNOT00000045368 ; Ctdspl; intron 4
Database links

Mature sequence rno-miR-26a-5p

Accession MIMAT0000796
Previous IDs rno-miR-26a
Sequence

16 - 

uucaaguaauccaggauaggcu

 - 37

Get sequence
Evidence experimental; cloned [1-3], SOLiD [4]
Validated targets
Predicted targets

Mature sequence rno-miR-26a-3p

Accession MIMAT0017100
Previous IDs rno-miR-26a*
Sequence

55 - 

ccuauucuugguuacuugcac

 - 75

Get sequence
Evidence experimental; SOLiD [4]
Predicted targets

References

1
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17805466 "Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
4
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).