Stem-loop sequence hsa-mir-324

Accession MI0000813
Symbol HGNC:MIR324
Description Homo sapiens miR-324 stem-loop
Gene family MIPF0000165; mir-324
Stem-loop 
cu      gc     c   u c   a     u   u  aaag 
  gacuau  cuccc gca c ccu gggca ugg gu    c
  ||||||  ||||| ||| | ||| ||||| ||| ||     
  cugaug  ggggg cgu g gga cccgu acc ca    u
--      uu     u   c u   c     c   -  gagg
Get sequence
Deep sequencing
3651 reads, 31 experiments
Comments

This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2]. Expression of the miRNA from the 3' arm of the hairpin was later verified in human BC-1 cells [3]. The 5' end of the miRNA may be offset with respect to previous annotations. miR-324-3p cloned in [4] has a 1 nt 3' extension (U), which is incompatible with the genome sequence.

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr17: 7126616-7126698 [-]
antisense
OTTHUMT00000444807 ; ACADVL-035; intron 1
OTTHUMT00000444808 ; ACADVL-034; intron 1
OTTHUMT00000444795 ; ACADVL-021; intron 1
OTTHUMT00000444796 ; ACADVL-022; intron 1
OTTHUMT00000444797 ; ACADVL-024; intron 1
OTTHUMT00000444800 ; ACADVL-026; intron 1
OTTHUMT00000444823 ; ACADVL-041; intron 1
OTTHUMT00000444794 ; ACADVL-020; intron 2
OTTHUMT00000444677 ; ACADVL-006; intron 10
OTTHUMT00000444676 ; ACADVL-002; intron 10
OTTHUMT00000220001 ; ACADVL-001; intron 11
OTTHUMT00000220001 ; ACADVL-001; intron 11
OTTHUMT00000220001 ; ACADVL-001; intron 11
OTTHUMT00000444679 ; ACADVL-007; intron 12
ENST00000578824 ; ACADVL-035; intron 1
ENST00000585203 ; ACADVL-034; intron 1
ENST00000579425 ; ACADVL-021; intron 1
ENST00000578579 ; ACADVL-022; intron 1
ENST00000542255 ; ACADVL-024; intron 1
ENST00000578543 ; ACADVL-026; intron 1
ENST00000579546 ; ACADVL-041; intron 1
ENST00000583858 ; ACADVL-020; intron 2
ENST00000350303 ; ACADVL-202; intron 10
ENST00000350303 ; ACADVL-202; intron 10
ENST00000322910 ; ACADVL-006; intron 10
ENST00000350303 ; ACADVL-002; intron 10
ENST00000356839 ; ACADVL-001; intron 11
ENST00000542255 ; ACADVL-203; intron 11
ENST00000322910 ; ACADVL-201; intron 11
ENST00000356839 ; ACADVL-001; intron 11
ENST00000542255 ; ACADVL-203; intron 11
ENST00000322910 ; ACADVL-201; intron 11
ENST00000356839 ; ACADVL-001; intron 11
ENST00000543245 ; ACADVL-204; intron 12
ENST00000543245 ; ACADVL-204; intron 12
ENST00000543245 ; ACADVL-007; intron 12
Database links

Mature sequence hsa-miR-324-5p

Accession MIMAT0000761
Sequence

16 -  

cgcauccccuagggcauuggugu

 - 38

Get sequence
Deep sequencing 2956 reads, 30 experiments
Evidence experimental; cloned [4-5]
Validated targets
Predicted targets

Mature sequence hsa-miR-324-3p

Accession MIMAT0000762
Sequence

53 -  

acugccccaggugcugcugg

 - 72

Get sequence
Deep sequencing 669 reads, 28 experiments
Evidence experimental; cloned [3-5]
Validated targets
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
3
PMID:15800047 "Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells" Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR Proc Natl Acad Sci U S A. 102:5570-5575(2005).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).