Stem-loop sequence mmu-mir-378a

Accession MI0000795
Previous IDs mmu-mir-378
Symbol MGI:Mir378
Description Mus musculus miR-378 stem-loop
Gene family MIPF0000168; mir-378
Stem-loop
   g  c              ugu      ccu 
agg cu cugacuccaggucc   guguua   c
||| || ||||||||||||||   ||||||    
ucc ga gacugagguucagg   cacgau   g
   g  a              --u      aaa 
Get sequence
Deep sequencing
3969842 reads, 97 experiments
Genome context
Coordinates (GRCm38) Overlapping transcripts
chr18: 61397835-61397900 [-]
sense
OTTMUST00000059063 ; Ppargc1b-003; intron 1
OTTMUST00000058872 ; Ppargc1b-002; intron 1
OTTMUST00000058693 ; Ppargc1b-001; intron 1
ENSMUST00000142134 ; Ppargc1b-003; intron 1
ENSMUST00000063307 ; Ppargc1b-002; intron 1
ENSMUST00000075299 ; Ppargc1b-001; intron 1
antisense
ENSMUST00000175285 ; AC116595.1-201; exon 1
Database links

Mature sequence mmu-miR-378a-5p

Accession MIMAT0000742
Previous IDs mmu-miR-378;mmu-miR-378*;mmu-miR-378-5p
Sequence

5 - 

cuccugacuccagguccugugu

 - 26

Get sequence
Deep sequencing 5885 reads, 76 experiments
Evidence experimental; cloned [1-2], Solexa [3-4]
Predicted targets

Mature sequence mmu-miR-378a-3p

Accession MIMAT0003151
Previous IDs mmu-miR-422b;mmu-miR-378;mmu-miR-378-3p
Sequence

43 - 

acuggacuuggagucagaagg

 - 63

Get sequence
Deep sequencing 3682251 reads, 82 experiments
Evidence experimental; cloned [2], Solexa [3-4]
Validated targets
Predicted targets

References

1
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).