Stem-loop sequence hsa-mir-380

AccessionMI0000788
Symbol HGNC:MIR380
DescriptionHomo sapiens miR-380 stem-loop
Gene family MIPF0000126; mir-379
Stem-loop
         guu       ga       c   c 
5' aagaug   gaccaua  acaugcg uau u
   ||||||   |||||||  ||||||| |||  
3' uucuac   cugguau  uguaugc gug c
         -ac       aa       u   u 
Get sequence
Deep sequencing
587 reads, 67 reads per million, 24 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Comments

Landgraf et al. confirm that the 3' product is the predominant one [3].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr14: 101025017-101025077 [+]
antisense
OTTHUMT00000414334 ; BEGAIN-007; intron 1
OTTHUMT00000414329 ; BEGAIN-001; intron 2
OTTHUMT00000414331 ; BEGAIN-005; intron 2
OTTHUMT00000414332 ; BEGAIN-003; intron 2
OTTHUMT00000414335 ; BEGAIN-006; intron 2
OTTHUMT00000414337 ; BEGAIN-004; intron 2
ENST00000557378 ; BEGAIN-007; intron 1
ENST00000443071 ; BEGAIN-201; intron 1
ENST00000355173 ; BEGAIN-001; intron 2
ENST00000553553 ; BEGAIN-005; intron 2
ENST00000556188 ; BEGAIN-003; intron 2
ENST00000554140 ; BEGAIN-006; intron 2
ENST00000554747 ; BEGAIN-004; intron 2
Clustered miRNAs
< 10kb from hsa-mir-380
hsa-mir-379chr14: 101022066-101022132 [+]
hsa-mir-411chr14: 101023325-101023420 [+]
hsa-mir-299chr14: 101023794-101023856 [+]
hsa-mir-380chr14: 101025017-101025077 [+]
hsa-mir-1197chr14: 101025564-101025651 [+]
hsa-mir-323achr14: 101025732-101025817 [+]
hsa-mir-758chr14: 101026020-101026107 [+]
hsa-mir-329-1chr14: 101026785-101026864 [+]
hsa-mir-329-2chr14: 101027100-101027183 [+]
hsa-mir-494chr14: 101029634-101029714 [+]
hsa-mir-1193chr14: 101030052-101030129 [+]
hsa-mir-543chr14: 101031987-101032064 [+]
hsa-mir-495chr14: 101033755-101033836 [+]
Database links

Mature sequence hsa-miR-380-5p

Accession MIMAT0000734
Previous IDshsa-miR-380-5p;hsa-miR-380*
Sequence

5 - 

ugguugaccauagaacaugcgc

 - 26

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence by similarity; MI0000797
Validated targets
Predicted targets

Mature sequence hsa-miR-380-3p

Accession MIMAT0000735
Previous IDshsa-miR-380-3p;hsa-miR-380
Sequence

40 - 

uauguaauaugguccacaucuu

 - 61

Get sequence
Deep sequencing70 reads, 15 experiments
Evidence experimental; cloned [3]
Predicted targets

References

1
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
2
PMID:15310658 "A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain" Seitz H, Royo H, Bortolin ML, Lin SP, Ferguson-Smith AC, Cavaille J Genome Res. 14:1741-1748(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).