|
miRBase |
|
Stem-loop sequence hsa-mir-378a |
|||||
| Accession | MI0000786 | ||||
| Previous IDs | hsa-mir-378 | ||||
| Symbol | HGNC:MIR378 | ||||
| Description | Homo sapiens miR-378a stem-loop | ||||
| Gene family | MIPF0000168; mir-378 | ||||
| Stem-loop |
g c ugu ccu agg cu cugacuccaggucc guguua a ||| || |||||||||||||| |||||| ucc ga gacugagguucagg cacgau g g a --u aaa |
||||
| Deep sequencing |
| ||||
| Comments |
miR-422b was the most abundant miRNA cloned from human promyelocytic leukemia (HL-60) cells [2]. The sequence originates from the opposite arm of the human homologue of previously identified mouse mir-378 [1]. Landgraf et al. show that the 3' product (previously called miR-422b) is the predominant one [3]. Further, mir-378 and mir-422a loci are unrelated. miR-422b is thus renamed miR-378 here. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The 5' end of the miRNA may be offset with respect to previous annotations. |
||||
| Genome context |
|
||||
| Database links | |||||
Mature sequence hsa-miR-378a-5p |
|
| Accession | MIMAT0000731 |
| Previous IDs | hsa-miR-378;hsa-miR-378* |
| Sequence |
5 - cuccugacuccagguccugugu - 26 |
| Deep sequencing | 267 reads, 25 experiments |
| Evidence | experimental; cloned [3] |
| Validated targets |
|
| Predicted targets |
|
Mature sequence hsa-miR-378a-3p |
|
| Accession | MIMAT0000732 |
| Previous IDs | hsa-miR-422b;hsa-miR-378 |
| Sequence |
43 - acuggacuuggagucagaagg - 63 |
| Deep sequencing | 439353 reads, 33 experiments |
| Evidence | experimental; cloned [2-3], Northern [2] |
| Validated targets |
|
| Predicted targets |
|
References |
|
| 1 |
PMID:15538371
"A pancreatic islet-specific microRNA regulates insulin secretion"
Nature. 432:226-230(2004).
|
| 2 |
PMID:15325244
"Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells"
Biochem Biophys Res Commun. 322:403-410(2004).
|
| 3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|