Stem-loop sequence hsa-mir-376a-1

AccessionMI0000784
Previous IDshsa-mir-376a
Symbol HGNC:MIR376A1
DescriptionHomo sapiens miR-376a-1 stem-loop
Gene family MIPF0000091; mir-368
Stem-loop
   u    g  a    c    u      --gua   u 
5'  aaaa gu gauu uccu cuauga     cau a
    |||| || |||| |||| ||||||     ||| u
3'  uuuu ca cuaa agga gauacu     gua u
   c    g  c    a    -      aauua   u 
Get sequence
Deep sequencing
3683 reads, 1.01e+03 reads per million, 50 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature miR-376a products have been shown to be modified by A to I edits [3].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr14: 101040782-101040849 [+]
antisense
OTTHUMT00000414335 ; BEGAIN-006; intron 1
ENST00000554140 ; BEGAIN-006; intron 1
Clustered miRNAs
< 10kb from hsa-mir-376a-1
hsa-mir-543chr14: 101031987-101032064 [+]
hsa-mir-495chr14: 101033755-101033836 [+]
hsa-mir-376cchr14: 101039690-101039755 [+]
hsa-mir-376a-2chr14: 101040069-101040148 [+]
hsa-mir-654chr14: 101040219-101040299 [+]
hsa-mir-376bchr14: 101040436-101040535 [+]
hsa-mir-376a-1chr14: 101040782-101040849 [+]
hsa-mir-300chr14: 101041363-101041445 [+]
hsa-mir-1185-1chr14: 101042977-101043062 [+]
hsa-mir-1185-2chr14: 101044198-101044283 [+]
hsa-mir-381chr14: 101045920-101045994 [+]
hsa-mir-487bchr14: 101046455-101046538 [+]
hsa-mir-539chr14: 101047321-101047398 [+]
hsa-mir-889chr14: 101047901-101047979 [+]
hsa-mir-544achr14: 101048658-101048748 [+]
hsa-mir-655chr14: 101049550-101049646 [+]
Database links

Mature sequence hsa-miR-376a-5p

Accession MIMAT0003386
Previous IDshsa-miR-376a*
Sequence

7 - 

guagauucuccuucuaugagua

 - 28

Get sequence
Deep sequencing61 reads, 20 experiments
Evidence experimental; cloned [2,4]
Validated targets
Predicted targets

Mature sequence hsa-miR-376a-3p

Accession MIMAT0000729
Previous IDshsa-miR-376a
Sequence

44 - 

aucauagaggaaaauccacgu

 - 64

Get sequence
Deep sequencing697 reads, 26 experiments
Evidence experimental; cloned [1,3], SOLiD [4]
Validated targets
Predicted targets

References

1
PMID:15891114 "Clustering and conservation patterns of human microRNAs" Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H Nucleic Acids Res. 33:2697-2706(2005).
2
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
3
PMID:17322061 "Redirection of silencing targets by adenosine-to-inosine editing of miRNAs" Kawahara Y, Zinshteyn B, Sethupathy P, Iizasa H, Hatzigeorgiou AG, Nishikura K Science. 315:1137-1140(2007).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).