Stem-loop sequence hsa-mir-372

AccessionMI0000780
Symbol HGNC:MIR372
DescriptionHomo sapiens miR-372 stem-loop
Gene family MIPF0000068; mir-290
Stem-loop
   gug   -         g -      a    gaug 
5'    ggc cucaaaugu g agcacu uucu    u
      ||| ||||||||| | |||||| ||||    c
3'    cug gaguuuaca c ucguga aagg    c
   -ca   c         g g      -    ugaa 
Get sequence
Deep sequencing
93 reads, 108 reads per million, 16 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chr19: 53787890-53787956 [+]
sense
OTTHUMT00000464289 ; FAM90A27P-001; exon 4
ENST00000593323 ; FAM90A27P-001; exon 4
ENST00000338885 ; FAM90A27P-201; exon 4
Clustered miRNAs
< 10kb from hsa-mir-372
hsa-mir-371achr19: 53787675-53787741 [+]
hsa-mir-371bchr19: 53787677-53787742 [-]
hsa-mir-372chr19: 53787890-53787956 [+]
hsa-mir-373chr19: 53788705-53788773 [+]
Database links

Mature sequence hsa-miR-372-5p

Accession MIMAT0026484
Sequence

6 - 

ccucaaauguggagcacuauucu

 - 28

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [3]
Predicted targets

Mature sequence hsa-miR-372-3p

Accession MIMAT0000724
Sequence

42 - 

aaagugcugcgacauuugagcgu

 - 64

Get sequence
Deep sequencing7 reads, 4 experiments
Evidence experimental; cloned [1-2], Northern [1], Illumina [3]
Validated targets
Predicted targets

References

1
PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).