Stem-loop sequence hsa-mir-302d

Accession

MI0000774

Symbol

HGNC:MIR302D

Description

Homo sapiens miR-302d stem-loop

Gene family

MIPF0000071; mir-302

Stem-loop

  u u    u                ---c   ga 
cc c acuu aacauggaggcacuug    ugu  c
|| | |||| ||||||||||||||||    |||   
gg g ugag uuguaccuucgugaau    aca  a
  u -    u                aaaa   gu 

Deep sequencing

57223 reads, 5 experiments

Comments

Human miR-302a (MI0000738 ), miR-302b (MI0000772 ), miR-302c (MI0000773 ), miR-302d (MI0000774 ) and miR-367 (MI0000775 ) are clustered on chromosome 4.

Genome context

• Coordinates (GRCh37.p5): chr4: 113569160-113569227 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000365316 ; RP11-148B6.1-001; intron 1

  OTTHUMT00000365318 ; RP11-148B6.1-003; intron 1

  OTTHUMT00000365316 ; RP11-148B6.1-001; intron 1

  OTTHUMT00000365318 ; RP11-148B6.1-003; intron 1

  OTTHUMT00000365316 ; RP11-148B6.1-001; intron 1

  OTTHUMT00000365318 ; RP11-148B6.1-003; intron 1

  OTTHUMT00000365317 ; RP11-148B6.1-002; intron 2

  OTTHUMT00000365317 ; RP11-148B6.1-002; intron 2

  OTTHUMT00000365317 ; RP11-148B6.1-002; intron 2

  ENST00000509938 ; RP11-148B6.1-001; intron 1

  ENST00000505215 ; RP11-148B6.1-003; intron 1

  ENST00000509938 ; RP11-148B6.1-001; intron 1

  ENST00000505215 ; RP11-148B6.1-003; intron 1

  ENST00000509938 ; RP11-148B6.1-001; intron 1

  ENST00000505215 ; RP11-148B6.1-003; intron 1

  ENST00000510655 ; RP11-148B6.1-002; intron 2

  ENST00000510655 ; RP11-148B6.1-002; intron 2

  ENST00000510655 ; RP11-148B6.1-002; intron 2

  antisense

  OTTHUMT00000365309 ; LARP7-013; intron 2

  OTTHUMT00000365309 ; LARP7-013; intron 2

  OTTHUMT00000365309 ; LARP7-013; intron 2

  OTTHUMT00000365307 ; LARP7-011; intron 3

  OTTHUMT00000365307 ; LARP7-011; intron 3

  OTTHUMT00000365307 ; LARP7-011; intron 3

  OTTHUMT00000256417 ; LARP7-001; intron 8

  OTTHUMT00000363892 ; LARP7-003; intron 8

  OTTHUMT00000256417 ; LARP7-001; intron 8

  OTTHUMT00000363892 ; LARP7-003; intron 8

  OTTHUMT00000256417 ; LARP7-001; intron 8

  OTTHUMT00000363892 ; LARP7-003; intron 8

  OTTHUMT00000363891 ; LARP7-002; intron 10

  OTTHUMT00000363891 ; LARP7-002; intron 10

  OTTHUMT00000363891 ; LARP7-002; intron 10

  ENST00000511529 ; LARP7-013; intron 2

  ENST00000511529 ; LARP7-013; intron 2

  ENST00000511529 ; LARP7-013; intron 2

  ENST00000513553 ; LARP7-011; intron 3

  ENST00000513553 ; LARP7-011; intron 3

  ENST00000513553 ; LARP7-011; intron 3

  ENST00000344442 ; LARP7-001; intron 8

  ENST00000509622 ; LARP7-003; intron 8

  ENST00000324052 ; LARP7-201; intron 8

  ENST00000344442 ; LARP7-001; intron 8

  ENST00000509622 ; LARP7-003; intron 8

  ENST00000324052 ; LARP7-201; intron 8

  ENST00000344442 ; LARP7-001; intron 8

  ENST00000509622 ; LARP7-003; intron 8

  ENST00000324052 ; LARP7-201; intron 8

  ENST00000509061 ; LARP7-002; intron 10

  ENST00000509061 ; LARP7-002; intron 10

  ENST00000509061 ; LARP7-002; intron 10

Clustered miRNAs

< 10kb from hsa-mir-302d

• hsa-mir-302b: chr4: 113569641-113569713 [-]
• hsa-mir-302c: chr4: 113569519-113569586 [-]
• hsa-mir-302a: chr4: 113569339-113569407 [-]
• hsa-mir-302d: chr4: 113569160-113569227 [-]
• hsa-mir-367: chr4: 113569030-113569097 [-]

Database links

• ENTREZGENE: 442896;MIR302D
• HGNC: 31765;MIR302D

Mature sequence hsa-miR-302d-5p

• Accession: MIMAT0004685
• Previous IDs: hsa-miR-302d*
• Sequence: 6 - acuuuaacauggaggcacuugc - 27
• Deep sequencing: 2 reads, 1 experiments
• Evidence: experimental; cloned [2]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-302d-5p
  • MICRORNA.ORG:hsa-miR-302d-5p
  • MIRDB:hsa-miR-302d-5p
  • RNA22-HSA:hsa-miR-302d-5p
  • TARGETMINER:hsa-miR-302d-5p
  • PICTAR-VERT:hsa-miR-302d

Mature sequence hsa-miR-302d-3p

• Accession: MIMAT0000718
• Previous IDs: hsa-miR-302d
• Sequence: 44 - uaagugcuuccauguuugagugu - 66
• Deep sequencing: 57221 reads, 5 experiments
• Evidence: experimental; cloned [1-2], Northern [1]
• Validated targets:
  • TARBASE:hsa-miR-302d-3p
• Predicted targets:
  • DIANA-MICROT:hsa-miR-302d-3p
  • MICRORNA.ORG:hsa-miR-302d-3p
  • MIRDB:hsa-miR-302d-3p
  • RNA22-HSA:hsa-miR-302d-3p
  • TARGETMINER:hsa-miR-302d-3p
  • TARGETSCAN-VERT:hsa-miR-302d
  • PICTAR-VERT:hsa-miR-302d

References

1. PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).