Stem-loop sequence hsa-mir-302c

AccessionMI0000773
Symbol HGNC:MIR302C
DescriptionHomo sapiens miR-302c stem-loop
Gene family MIPF0000071; mir-302
Stem-loop
       ug  uu             c    -g  u 
5' ccuu  cu  aacauggggguac ugcu  ug g
   ||||  ||  ||||||||||||| ||||  || a
3' ggag  ga  uuguaccuucgug auga  ac a
       gu  cu             a    aa  a 
Get sequence
Deep sequencing
86569 reads, 1.35e+05 reads per million, 10 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chr4: 112648363-112648430 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-302c
hsa-mir-302bchr4: 112648485-112648557 [-]
hsa-mir-302cchr4: 112648363-112648430 [-]
hsa-mir-302achr4: 112648183-112648251 [-]
hsa-mir-302dchr4: 112648004-112648071 [-]
hsa-mir-367chr4: 112647874-112647941 [-]
Database links

Mature sequence hsa-miR-302c-5p

Accession MIMAT0000716
Previous IDshsa-miR-302c*
Sequence

8 - 

uuuaacauggggguaccugcug

 - 29

Get sequence
Deep sequencing6 reads, 2 experiments
Evidence experimental; cloned [1-2], Northern [1]
Predicted targets

Mature sequence hsa-miR-302c-3p

Accession MIMAT0000717
Previous IDshsa-miR-302c
Sequence

43 - 

uaagugcuuccauguuucagugg

 - 65

Get sequence
Deep sequencing8444 reads, 3 experiments
Evidence experimental; cloned [1-2], Northern [1]
Validated targets
Predicted targets

References

1
PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).