Stem-loop sequence hsa-mir-365a

Accession MI0000767
Previous IDs hsa-mir-365-1
Symbol HGNC:MIR365-1
Description Homo sapiens miR-365a stem-loop
Gene family MIPF0000061; mir-365
Stem-loop
acc      aa        ac           ----   -   uuu 
   gcaggg  aaugaggg  uuuugggggca    gau gug   c
   ||||||  ||||||||  |||||||||||    ||| |||   c
   cguucu  uuauuccu  aaaauccccgu    cua cac   a
--a      cg        -a           aaua   u   cuu 
Get sequence
Deep sequencing
8839 reads, 27 experiments
Comments

Xie et al. [1] refer to this sequence by the internal identifier MIR245. The sequence is unrelated to C. elegans mir-245 (MI0000321 ).

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr16: 14403142-14403228 [+]
sense
OTTHUMT00000436878 ; RP11-65J21.3-001; intron 1
OTTHUMT00000436879 ; RP11-65J21.3-003; intron 1
OTTHUMT00000436878 ; RP11-65J21.3-001; intron 1
OTTHUMT00000436879 ; RP11-65J21.3-003; intron 1
ENST00000570945 ; RP11-65J21.3-001; intron 1
ENST00000571639 ; RP11-65J21.3-003; intron 1
ENST00000570945 ; RP11-65J21.3-001; intron 1
ENST00000571639 ; RP11-65J21.3-003; intron 1
Clustered miRNAs
< 10kb from hsa-mir-365a
hsa-mir-193b chr16: 14397824-14397906 [+]
hsa-mir-365a chr16: 14403142-14403228 [+]
Database links

Mature sequence hsa-miR-365a-5p

Accession MIMAT0009199
Previous IDs hsa-miR-365*
Sequence

16 - 

agggacuuuugggggcagaugug

 - 38

Get sequence
Deep sequencing 2159 reads, 13 experiments
Evidence not experimental
Predicted targets

Mature sequence hsa-miR-365a-3p

Accession MIMAT0000710
Previous IDs hsa-miR-365
Sequence

56 - 

uaaugccccuaaaaauccuuau

 - 77

Get sequence
Deep sequencing 6679 reads, 26 experiments
Evidence experimental; cloned [1,3-4], array-cloned [2]
Validated targets
Predicted targets

References

1
PMID:15735639 "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals" Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M Nature. 434:338-345(2005).
2
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).