Stem-loop sequence hsa-mir-365a

AccessionMI0000767
Previous IDshsa-mir-365-1
Symbol HGNC:MIR365-1
DescriptionHomo sapiens miR-365a stem-loop
Gene family MIPF0000061; mir-365
Stem-loop
   acc      aa        ac           ----   -   uuu 
5'    gcaggg  aaugaggg  uuuugggggca    gau gug   c
      ||||||  ||||||||  |||||||||||    ||| |||   c
3'    cguucu  uuauuccu  aaaauccccgu    cua cac   a
   --a      cg        -a           aaua   u   cuu 
Get sequence
Deep sequencing
13660 reads, 3.85e+03 reads per million, 69 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Xie et al. [1] refer to this sequence by the internal identifier MIR245. The sequence is unrelated to C. elegans mir-245 (MI0000321).

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr16: 14309285-14309371 [+]
sense
OTTHUMT00000436627 ; MKL2-004; intron 4
OTTHUMT00000436628 ; MKL2-005; intron 4
OTTHUMT00000436621 ; MKL2-001; intron 6
OTTHUMT00000436622 ; MKL2-002; intron 6
ENST00000572567 ; MKL2-004; intron 4
ENST00000573051 ; MKL2-005; intron 4
ENST00000341243 ; MKL2-202; intron 4
ENST00000318282 ; MKL2-201; intron 5
ENST00000571589 ; MKL2-001; intron 6
ENST00000574045 ; MKL2-002; intron 6
Clustered miRNAs
< 10kb from hsa-mir-365a
hsa-mir-193bchr16: 14303967-14304049 [+]
hsa-mir-365achr16: 14309285-14309371 [+]
Database links

Mature sequence hsa-miR-365a-5p

Accession MIMAT0009199
Previous IDshsa-miR-365*
Sequence

16 - 

agggacuuuugggggcagaugug

 - 38

Get sequence
Deep sequencing2894 reads, 24 experiments
Evidence not experimental
Predicted targets

Mature sequence hsa-miR-365a-3p

Accession MIMAT0000710
Previous IDshsa-miR-365
Sequence

56 - 

uaaugccccuaaaaauccuuau

 - 77

Get sequence
Deep sequencing1370 reads, 62 experiments
Evidence experimental; cloned [1,3-4], array-cloned [2]
Validated targets
Predicted targets

References

1
PMID:15735639 "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals" Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M Nature. 434:338-345(2005).
2
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).