Stem-loop sequence hsa-mir-362

AccessionMI0000762
Symbol HGNC:MIR362
DescriptionHomo sapiens miR-362 stem-loop
Gene family MIPF0000209; mir-362
Stem-loop
   c             acc        -a ug  a 
5'  uugaauccuugga   uaggugug  g  cu u
    |||||||||||||   ||||||||  |  || u
3'  aacuuaggaacuu   auccacac  c  ga u
   a             ---        aa gu  c 
Get sequence
Deep sequencing
2731 reads, 673 reads per million, 62 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chrX: 50008964-50009028 [+]
sense
OTTHUMT00000056562 ; CCNB3-005; intron 1
OTTHUMT00000056558 ; CCNB3-001; intron 1
OTTHUMT00000056559 ; CCNB3-002; intron 1
OTTHUMT00000056560 ; CCNB3-003; intron 1
OTTHUMT00000056561 ; CCNB3-004; intron 2
ENST00000491907 ; CCNB3-005; intron 1
ENST00000376042 ; CCNB3-001; intron 1
ENST00000376038 ; CCNB3-002; intron 1
ENST00000476167 ; CCNB3-003; intron 1
ENST00000493507 ; CCNB3-004; intron 2
Clustered miRNAs
< 10kb from hsa-mir-362
hsa-mir-532chrX: 50003148-50003238 [+]
hsa-mir-188chrX: 50003503-50003588 [+]
hsa-mir-500achrX: 50008431-50008514 [+]
hsa-mir-362chrX: 50008964-50009028 [+]
hsa-mir-501chrX: 50009722-50009805 [+]
hsa-mir-500bchrX: 50010672-50010750 [+]
hsa-mir-660chrX: 50013241-50013337 [+]
hsa-mir-502chrX: 50014598-50014683 [+]
Database links

Mature sequence hsa-miR-362-5p

Accession MIMAT0000705
Previous IDshsa-miR-362
Sequence

5 - 

aauccuuggaaccuaggugugagu

 - 28

Get sequence
Deep sequencing597 reads, 50 experiments
Evidence experimental; array-cloned [1], cloned [2-3]
Predicted targets

Mature sequence hsa-miR-362-3p

Accession MIMAT0004683
Sequence

42 - 

aacacaccuauucaaggauuca

 - 63

Get sequence
Deep sequencing972 reads, 51 experiments
Evidence experimental; cloned [3]
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).