Stem-loop sequence rno-mir-343

Accession MI0000628
Description Rattus norvegicus miR-343 stem-loop
Gene family MIPF0000411; mir-343
Stem-loop 
gcaccuucauggacc   --a    - -g    ug  g         c   --     
               ugg   guag a  uggg  ug cggggggag agg  gccc 
               |||   |||| |  ||||  || ||||||||| |||  ||| a
               acc   cguc u  accc  gu gccucccuc ucc  cggg 
--------------a   gua    c ag    gu  -         -   aa
Get sequence
Comments

Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. The sequence reported in [1] contains a 3' terminal UU sequence, which conflicts with the precursor sequence shown here.

Genome context
Coordinates (RGSC3.4) Overlapping transcripts
1: 78904571-78904663 [+]
sense
ENSRNOT00000024246 ; LOC100364929; intron 7
ENSRNOT00000024246 ; LOC100364929; 3'UTR (exon 8)
ENSRNOT00000024246 ; LOC100364929; 3'UTR (exon 8)
Database links
  • ENTREZGENE: 100314183;Mir343

Mature sequence rno-miR-343

Accession MIMAT0000591
Sequence

61 -  

ucucccuccgugugcccaga

 - 80

Get sequence
Evidence experimental; cloned [1], SOLiD [2]
Predicted targets

References

1
PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).