Stem-loop sequence hsa-mir-126

Accession MI0000471
Symbol HGNC:MIR126
Description Homo sapiens miR-126 stem-loop
Gene family MIPF0000115; mir-126
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-126. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-126 is a short non-coding RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several pre- and post-transcription mechanisms. mir-126 is a human microRNA that is expressed only in endothelial cells, throughout capillaries as well as larger blood vessels, and acts upon various transcripts to control angiogenesis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
c    gc     - a           u       c cug   c 
 gcug  gacgg g cauuauuacuu ugguacg g   uga a
 ||||  ||||| | ||||||||||| ||||||| |   |||  
 cggc  cugcc c guaauaaugag gccaugc c   acu c
a    ac     g -           u       u -aa   u 
Get sequence
Deep sequencing
4937 reads, 55 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr9: 139565054-139565138 [+]
sense
OTTHUMT00000055099 ; EGFL7-006; intron 5
OTTHUMT00000055099 ; EGFL7-006; intron 5
OTTHUMT00000055099 ; EGFL7-006; intron 5
OTTHUMT00000055096 ; EGFL7-003; intron 6
OTTHUMT00000055096 ; EGFL7-003; intron 6
OTTHUMT00000055096 ; EGFL7-003; intron 6
OTTHUMT00000055094 ; EGFL7-001; intron 7
OTTHUMT00000055095 ; EGFL7-002; intron 7
OTTHUMT00000055094 ; EGFL7-001; intron 7
OTTHUMT00000055095 ; EGFL7-002; intron 7
OTTHUMT00000055094 ; EGFL7-001; intron 7
OTTHUMT00000055095 ; EGFL7-002; intron 7
ENST00000492002 ; EGFL7-006; intron 5
ENST00000492002 ; EGFL7-006; intron 5
ENST00000492002 ; EGFL7-006; intron 5
ENST00000371698 ; EGFL7-003; intron 6
ENST00000371698 ; EGFL7-003; intron 6
ENST00000371698 ; EGFL7-003; intron 6
ENST00000371699 ; EGFL7-001; intron 7
ENST00000406555 ; EGFL7-002; intron 7
ENST00000308874 ; EGFL7-201; intron 7
ENST00000371699 ; EGFL7-001; intron 7
ENST00000406555 ; EGFL7-002; intron 7
ENST00000308874 ; EGFL7-201; intron 7
ENST00000371699 ; EGFL7-001; intron 7
ENST00000406555 ; EGFL7-002; intron 7
ENST00000308874 ; EGFL7-201; intron 7
Database links

Mature sequence hsa-miR-126-5p

Accession MIMAT0000444
Previous IDs hsa-miR-126*
Sequence

15 - 

cauuauuacuuuugguacgcg

 - 35

Get sequence
Deep sequencing 786 reads, 34 experiments
Evidence experimental; cloned [2]
Validated targets
Predicted targets

Mature sequence hsa-miR-126-3p

Accession MIMAT0000445
Previous IDs hsa-miR-126
Sequence

52 - 

ucguaccgugaguaauaaugcg

 - 73

Get sequence
Deep sequencing 4150 reads, 36 experiments
Evidence experimental; cloned [2]
Validated targets
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).