Stem-loop sequence dme-mir-2c

Accession MI0000431
Description Drosophila melanogaster miR-2c stem-loop
Gene family MIPF0000049; mir-2
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-2_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The mir-2 microRNA family includes the microRNA genes mir-2 and mir-13 (MIPF0000049). Mir-2 is widespread in invertebrates, and it is the largest family of microRNAs in the model species Drosophila melanogaster. MicroRNAs from this family are produced from the 3' arm of the precursor hairpin. Leaman et al. showed that the miR-2 family regulates cell survival by translational repression of proapoptotic factors. Based on computational prediction of targets, a role in neural development and maintenance has been suggested.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
    au    c  u       -      aag     aagaaagauauuucu 
ucgu  cuua uu caauguc aucaaa   ggcug               g
||||  |||| || ||||||| ||||||   |||||                
agcg  gagu aa guuacgg uaguuu   ccgac               c
    ac    -  c       g      cga     acuaugcuaaguuua 
Get sequence
Deep sequencing
1263837 reads, 50 experiments
Comments

miR-2c was predicted by similarity to miR-2a (MI0000117 ). Expression in Drosophila was independently confirmed by Northern blot analysis [1] and by cloning [2]. The latter study confirmed the ends of the excised miR. The sequence is localised to chromosome 3R. Stark et al. [3] have identified targets for miR-2 in Drosophila using computational prediction followed by experimental validation. miR-2 regulates the proapoptotic genes reaper, grim and sickle, suggesting that it may be involved in the control of apoptosis.

Genome context
Coordinates (BDGP5.0) Overlapping transcripts
3R: 11243466-11243567 [-]
intergenic
Clustered miRNAs
< 10kb from dme-mir-2c
dme-mir-2c 3R: 11243466-11243567 [-]
dme-mir-13a 3R: 11243264-11243338 [-]
dme-mir-13b-1 3R: 11243130-11243197 [-]

Mature sequence dme-miR-2c-5p

Accession MIMAT0020845
Sequence

20 - 

ucaucaaaaagggcugaagaaagau

 - 44

Get sequence
Deep sequencing 2209 reads, 39 experiments
Evidence not experimental
Predicted targets

Mature sequence dme-miR-2c-3p

Accession MIMAT0000411
Previous IDs dme-miR-2c
Sequence

63 - 

uaucacagccagcuuugaugggc

 - 85

Get sequence
Deep sequencing 1261628 reads, 50 experiments
Evidence experimental; Northern [1], cloned [2], 454 [4-5], Solexa [5]
Predicted targets

References

1
2
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
3
PMID:14691535 "Identification of Drosophila MicroRNA targets" Stark A, Brennecke J, Russell RB, Cohen SM PLoS Biol. 1:E60(2003).
4
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
5
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).