Stem-loop sequence mmu-mir-292

Accession MI0000390
Symbol MGI:Mir292
Description Mus musculus miR-292 stem-loop
Gene family MIPF0000068; mir-290
Stem-loop 
     u           --a    g   u    ugga     a 
cagcc gugauacucaa   cugg ggc cuuu    uuuuc u
||||| |||||||||||   |||| ||| ||||    |||||  
guugg cacugugaguu   gacc ccg gaaa    agaag c
     c           uug    g   u    ----     g
Get sequence
Deep sequencing
47340 reads, 51 experiments
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr7: 3219189-3219270 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-292
mmu-mir-290 chr7: 3218626-3218708 [+]
mmu-mir-291a chr7: 3218919-3219000 [+]
mmu-mir-292 chr7: 3219189-3219270 [+]
mmu-mir-291b chr7: 3219482-3219560 [+]
mmu-mir-293 chr7: 3220343-3220422 [+]
mmu-mir-294 chr7: 3220641-3220724 [+]
mmu-mir-295 chr7: 3220773-3220841 [+]
Database links

Mature sequence mmu-miR-292-5p

Accession MIMAT0000369
Sequence

12 -  

acucaaacugggggcucuuuug

 - 33

Get sequence
Deep sequencing 8495 reads, 24 experiments
Evidence experimental; cloned [1-2], Northern [1], Solexa [3-4]
Predicted targets

Mature sequence mmu-miR-292-3p

Accession MIMAT0000370
Sequence

50 -  

aaagugccgccagguuuugagugu

 - 73

Get sequence
Deep sequencing 37593 reads, 37 experiments
Evidence experimental; cloned [1-2], Northern [1], Solexa [3-4]
Validated targets
Predicted targets

References

1
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).