Stem-loop sequence hsa-mir-187

Accession

MI0000274 (change log)

Symbol

HGNC:MIR187

Description

Homo sapiens miR-187 stem-loop

Gene family

MIPF0000078; mir-187

Literature search

52 open access papers mention hsa-mir-187
(335 sentences)

Stem-loop

   g u      caccaugacacag    aga    g    a           c  -  c - ug 
5'  g cgggcu             ugug   ccuc ggcu caacacaggac cg gg g c  c
    | ||||||             ||||   |||| |||| ||||||||||| || || | |   
3'  c gccugg             acgc   ggag ccga guuguguucug gc cc c g  u
   a -      -------------    -ag    g    c           u  u  c a uc 

Deep sequencing

11980 reads, 112 reads per million, 103 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. Landgraf et al. confirm expression in human [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr18: 35904818-35904926 [-]
• Overlapping transcripts:

  intergenic

Database links

• EntrezGene:MIR187
• HGNC:MIR187
• RNAcentral:URS00005677F7_9606
• miRBase Tracker:MI0000274

Mature sequence hsa-miR-187-5p

• Accession: MIMAT0004561
• Previous IDs: hsa-miR-187*
• Sequence: 35 - ggcuacaacacaggacccgggc - 56
• Deep sequencing: 159 reads, 36 experiments
• Evidence: experimental; cloned [2]
• Database links:
  • RNAcentral:URS000047FD4C_9606
• Predicted targets:
  • TargetMiner:hsa-miR-187-5p
  • TargetScanVert:hsa-miR-187-5p
  • miRDB:hsa-miR-187-5p
  • microrna.org:hsa-miR-187-5p

Mature sequence hsa-miR-187-3p

• Accession: MIMAT0000262
• Previous IDs: hsa-miR-187
• Sequence: 71 - ucgugucuuguguugcagccgg - 92
• Deep sequencing: 11807 reads, 99 experiments
• Evidence: experimental; cloned [2]
• Database links:
  • RNAcentral:URS00001EB9FC_9606
• Predicted targets:
  • TargetMiner:hsa-miR-187-3p
  • TargetScanVert:hsa-miR-187-3p
  • miRDB:hsa-miR-187-3p
  • microrna.org:hsa-miR-187-3p

References

1. PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).