Stem-loop sequence hsa-mir-10a

Accession MI0000266
Symbol HGNC:MIR10A
Description Homo sapiens miR-10a stem-loop
Gene family MIPF0000033; mir-10
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-10_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-10 microRNA precursor is a short non-coding RNA gene involved in gene regulation. It is part of an RNA gene family which contains miR-10, miR-51, miR-57, miR-99 and miR-100. miR-10, miR-99 and miR-100 have now been predicted or experimentally confirmed in a wide range of species. (MIPF0000033, MIPF0000025) mir-51 and mir-57 have currently only been identified in the nematode Caenorhabditis elegans (MIPF0000268, MIPF0000271). microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 5' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
-----gauc   --c    uu        a    g     c          uaaggaa 
         ugu   uguc  cuguauau cccu uagau cgaauuugug       u
         |||   ||||  |||||||| |||| ||||| ||||||||||        
         aca   acag  gauguaua gggg aucua gcuuaaacac       u
ucucgccuc   aau    uu        a    -     u          ugguguu 
Get sequence
Deep sequencing
30193 reads, 52 experiments
Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Mature products were later verified in human [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr17: 46657200-46657309 [-]
sense
OTTHUMT00000358263 ; HOXB3-003; intron 1
OTTHUMT00000358262 ; HOXB3-002; intron 1
OTTHUMT00000358266 ; HOXB3-006; intron 1
OTTHUMT00000358265 ; HOXB3-005; intron 1
OTTHUMT00000358264 ; HOXB3-004; intron 1
OTTHUMT00000358269 ; HOXB3-009; 5'UTR (exon 1)
OTTHUMT00000408084 ; RP11-357H14.17-001; intron 1
OTTHUMT00000358259 ; HOXB4-001; 5'UTR (exon 1)
OTTHUMT00000408085 ; RP11-357H14.16-001; exon 1
OTTHUMT00000358263 ; HOXB3-003; intron 1
OTTHUMT00000358262 ; HOXB3-002; intron 1
OTTHUMT00000358266 ; HOXB3-006; intron 1
OTTHUMT00000358265 ; HOXB3-005; intron 1
OTTHUMT00000358264 ; HOXB3-004; intron 1
OTTHUMT00000440734 ; HOXB3-013; intron 1
OTTHUMT00000358259 ; HOXB4-001; 5'UTR (exon 1)
OTTHUMT00000408085 ; RP11-357H14.16-001; exon 1
OTTHUMT00000358263 ; HOXB3-003; intron 1
OTTHUMT00000358262 ; HOXB3-002; intron 1
OTTHUMT00000358266 ; HOXB3-006; intron 1
OTTHUMT00000358265 ; HOXB3-005; intron 1
OTTHUMT00000358264 ; HOXB3-004; intron 1
OTTHUMT00000440734 ; HOXB3-013; intron 1
OTTHUMT00000358259 ; HOXB4-001; 5'UTR (exon 1)
OTTHUMT00000408085 ; RP11-357H14.16-001; exon 1
ENST00000472863 ; HOXB3-003; intron 1
ENST00000498678 ; HOXB3-002; intron 1
ENST00000460160 ; HOXB3-006; intron 1
ENST00000489475 ; HOXB3-005; intron 1
ENST00000476342 ; HOXB3-004; intron 1
ENST00000465120 ; HOXB3-009; 5'UTR (exon 1)
ENST00000552000 ; RP11-357H14.17-001; intron 1
ENST00000332503 ; HOXB4-001; 5'UTR (exon 1)
ENST00000548801 ; RP11-357H14.16-001; exon 1
ENST00000472863 ; HOXB3-003; intron 1
ENST00000498678 ; HOXB3-002; intron 1
ENST00000460160 ; HOXB3-006; intron 1
ENST00000489475 ; HOXB3-005; intron 1
ENST00000476342 ; HOXB3-004; intron 1
ENST00000552000 ; HOXB3-013; intron 1
ENST00000332503 ; HOXB4-001; 5'UTR (exon 1)
ENST00000548801 ; RP11-357H14.16-001; exon 1
ENST00000472863 ; HOXB3-003; intron 1
ENST00000498678 ; HOXB3-002; intron 1
ENST00000460160 ; HOXB3-006; intron 1
ENST00000489475 ; HOXB3-005; intron 1
ENST00000476342 ; HOXB3-004; intron 1
ENST00000552000 ; HOXB3-013; intron 1
ENST00000332503 ; HOXB4-001; 5'UTR (exon 1)
ENST00000548801 ; hsa-mir-10a.1-001; exon 1
antisense
OTTHUMT00000358254 ; RP11-357H14.7-012; intron 1
OTTHUMT00000358254 ; RP11-357H14.7-012; intron 2
OTTHUMT00000358254 ; RP11-357H14.7-012; intron 2
ENST00000465846 ; RP11-357H14.7-012; intron 1
ENST00000465846 ; HOXB-AS3-012; intron 2
ENST00000465846 ; HOXB-AS3-012; intron 2
Database links

Mature sequence hsa-miR-10a-5p

Accession MIMAT0000253
Previous IDs hsa-miR-10a
Sequence

22 - 

uacccuguagauccgaauuugug

 - 44

Get sequence
Deep sequencing 30056 reads, 50 experiments
Evidence experimental; cloned [2-3]
Validated targets
Predicted targets

Mature sequence hsa-miR-10a-3p

Accession MIMAT0004555
Previous IDs hsa-miR-10a*
Sequence

63 - 

caaauucguaucuaggggaaua

 - 84

Get sequence
Deep sequencing 135 reads, 19 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).