Stem-loop sequence mmu-mir-199a-1

Accession

MI0000241

Previous IDs

mmu-mir-199-as;mmu-mir-199

Symbol

MGI:Mir199a-1

Description

Mus musculus miR-199a-1 stem-loop

Gene family

MIPF0000040; mir-199

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-199_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

The miR-199 microRNA precursor (homologous to miR-215), is a short non-coding RNA gene involved in gene regulation. miR-192 and miR-215 have now been predicted or experimentally confirmed in mouse, human and a further 21 other species. (MIPF0000040). microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. The mature products are thought to have regulatory roles through complementarity to mRNA.

Stem-loop

   auc       u        c   -------    g 
gcc   ccagugu cagacuac ugu       ucag a
|||   ||||||| |||||||| |||       ||||  
cgg   gguuaca gucugaug aca       gguc g
   auu       c        -   uguacag    g 

Deep sequencing

2315829 reads, 97 experiments

Comments

The hairpin precursor sequence mir-199 maps to two loci within 50 kb on mouse chromosome 9. This sequence was named mir-199 in [1] and [2], but is renamed here to avoid overlap with the predicted homologues of human mir-199a-2 and mir-199b. Landgraf et al. demonstrate comparable expression for products from both arms of the hairpin, which are therefore renamed miR-199a-5p and miR-199a-3p here [4]. The mature sequences shown here represent the most commonly cloned forms from large-scale cloning studies [4]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (GRCm38): chr9: 21496495-21496564 [-]
• Overlapping transcripts:

  antisense

  OTTMUST00000098127 ; Dnm2-011; intron 1

  OTTMUST00000098115 ; Dnm2-006; intron 6

  OTTMUST00000098123 ; Dnm2-010; intron 9

  OTTMUST00000098113 ; Dnm2-002; intron 14

  OTTMUST00000098112 ; Dnm2-005; intron 14

  OTTMUST00000098121 ; Dnm2-008; intron 15

  OTTMUST00000098111 ; Dnm2-004; intron 15

  OTTMUST00000098110 ; Dnm2-003; intron 15

  OTTMUST00000098109 ; Dnm2-001; intron 15

  ENSMUST00000173299 ; Dnm2-011; intron 1

  ENSMUST00000172763 ; Dnm2-006; intron 6

  ENSMUST00000172833 ; Dnm2-010; intron 9

  ENSMUST00000174050 ; Dnm2-002; intron 14

  ENSMUST00000091087 ; Dnm2-005; intron 14

  ENSMUST00000115404 ; Dnm2-201; intron 15

  ENSMUST00000172482 ; Dnm2-008; intron 15

  ENSMUST00000072362 ; Dnm2-004; intron 15

  ENSMUST00000173397 ; Dnm2-003; intron 15

  ENSMUST00000165766 ; Dnm2-001; intron 15

Database links

• EMBL: AJ560739;MMU560739
• ENTREZGENE: 387194;Mir199a-1
• MGI: 2676863;Mir199a-1

Mature sequence mmu-miR-199a-5p

• Accession: MIMAT0000229
• Previous IDs: mmu-miR-199a
• Sequence: 6 - cccaguguucagacuaccuguuc - 28
• Deep sequencing: 188578 reads, 67 experiments
• Evidence: experimental; cloned [2,4], Northern [2], Solexa [5-6]
• Validated targets:
  • MIRECORDS:mmu-miR-199a-5p
  • MIRTARBASE:mmu-miR-199a-5p
  • TARBASE:mmu-miR-199a-5p
• Predicted targets:
  • DIANA-MICROT:mmu-miR-199a-5p
  • MICRORNA.ORG:mmu-miR-199a-5p
  • MIRDB:mmu-miR-199a-5p
  • RNA22-MMU:mmu-miR-199a-5p
  • TARGETSCAN-VERT:mmu-miR-199a-5p

Mature sequence mmu-miR-199a-3p

• Accession: MIMAT0000230
• Previous IDs: mmu-miR-199a*
• Sequence: 46 - acaguagucugcacauugguua - 67
• Deep sequencing: 2125160 reads, 82 experiments
• Evidence: experimental; cloned [1-4], Northern [2], Solexa [5-6]
• Validated targets:
  • MIRECORDS:mmu-miR-199a-3p
  • TARBASE:mmu-miR-199a-3p
• Predicted targets:
  • DIANA-MICROT:mmu-miR-199a-3p
  • MICRORNA.ORG:mmu-miR-199a-3p
  • MIRDB:mmu-miR-199a-3p
  • RNA22-MMU:mmu-miR-199a-3p
  • TARGETSCAN-VERT:mmu-miR-199a-3p

References

1. PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2. PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3. PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).