Stem-loop sequence mmu-mir-10b

Accession MI0000221
Symbol MGI:Mir10b
Description Mus musculus miR-10b stem-loop
Gene family MIPF0000033; mir-10
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-10_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-10 microRNA precursor is a short non-coding RNA gene involved in gene regulation. It is part of an RNA gene family which contains miR-10, miR-51, miR-57, miR-99 and miR-100. miR-10, miR-99 and miR-100 have now been predicted or experimentally confirmed in a wide range of species. (MIPF0000033, MIPF0000025) mir-51 and mir-57 have currently only been identified in the nematode Caenorhabditis elegans (MIPF0000268, MIPF0000271). microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 5' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
     a    g     c          -ug  ac 
uauau cccu uagaa cgaauuugug   gu  c
||||| |||| ||||| ||||||||||   ||   
auaua gggg aucuu gcuuagacac   ua  c
     a    -     a          uga  ca 
Get sequence
Deep sequencing
619539 reads, 97 experiments
Comments

The sequence of mouse miR-10b, as reported by Lagos-Quintana et al. [1], is offset by 2 nt in the 3' direction with respect to sequences cloned from human (MI0000267 ) and zebrafish (MI0001364 ). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr2: 74726070-74726137 [+]
sense
OTTMUST00000040120 ; Hoxd3-001; intron 1
OTTMUST00000040121 ; Hoxd3-002; intron 5
ENSMUST00000111983 ; Hoxd3-001; intron 1
ENSMUST00000047904 ; Hoxd4-201; intron 4
ENSMUST00000144040 ; Hoxd3-002; intron 5
Database links

Mature sequence mmu-miR-10b-5p

Accession MIMAT0000208
Previous IDs mmu-miR-10b
Sequence

5 - 

uacccuguagaaccgaauuugug

 - 27

Get sequence
Deep sequencing 246174 reads, 82 experiments
Evidence experimental; cloned [1-2], Solexa [3-4]
Validated targets
Predicted targets

Mature sequence mmu-miR-10b-3p

Accession MIMAT0004538
Previous IDs mmu-miR-10b*
Sequence

45 - 

cagauucgauucuaggggaaua

 - 66

Get sequence
Deep sequencing 4572 reads, 45 experiments
Evidence experimental; cloned [2], Solexa [3-4]
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).