Stem-loop sequence mmu-mir-152

Accession

MI0000174

Symbol

MGI:Mir152

Description

Mus musculus miR-152 stem-loop

Gene family

MIPF0000056; mir-148

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-148/mir-152_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

In molecular biology, miR-148 is a microRNA whose expression has been demonstrated in human (MI0000253), mouse (MI0000550), rat (MI0000616) and zebrafish (MI0002015). miR-148 has also been predicted in chicken (MI0001189). These predicted hairpin precursor sequence are related to those of miR-152, which has been expressed in mouse (MI0000174) and is predicted in human (MI0000462). The hairpin precursors (represented here) are predicted based on base pairing and cross-species conservation; their extents are not known. In this case, the mature sequence is excised from the 3' arm of the hairpin.

Stem-loop

                 g  a    cc    cgg   c 
ccgggccuagguucugu au cacu  gacu   gcu u
||||||||||||||||| || ||||  ||||   |||  
ggcccggguucaagaca ua guga  cuga   cga g
                 g  c    --    ---   g 

Deep sequencing

595830 reads, 97 experiments

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context

• Coordinates (GRCm38): chr11: 96850393-96850465 [+]
• Overlapping transcripts:

  sense

  OTTMUST00000003414 ; Copz2-003; intron 1

  OTTMUST00000003223 ; Copz2-001; intron 1

  OTTMUST00000003413 ; Copz2-002; intron 1

  ENSMUST00000145633 ; Copz2-003; intron 1

  ENSMUST00000018816 ; Copz2-001; intron 1

  ENSMUST00000155696 ; Copz2-002; intron 1

Database links

• EMBL: AJ459764;MMU459764
• ENTREZGENE: 387170;Mir152
• MGI: 2676837;Mir152

Mature sequence mmu-miR-152-5p

• Accession: MIMAT0016991
• Previous IDs: mmu-miR-152*
• Sequence: 8 - uagguucugugauacacuccgacu - 31
• Deep sequencing: 613 reads, 53 experiments
• Evidence: experimental; 454 [6], Solexa [7]
• Predicted targets:
  • DIANA-MICROT:mmu-miR-152-5p
  • MIRDB:mmu-miR-152-5p
  • RNA22-MMU:mmu-miR-152-5p

Mature sequence mmu-miR-152-3p

• Accession: MIMAT0000162
• Previous IDs: mmu-miR-152
• Sequence: 47 - ucagugcaugacagaacuugg - 67
• Deep sequencing: 586685 reads, 82 experiments
• Evidence: experimental; cloned [1-4], Solexa [5,7]
• Validated targets:
  • TARBASE:mmu-miR-152-3p
• Predicted targets:
  • DIANA-MICROT:mmu-miR-152-3p
  • MICRORNA.ORG:mmu-miR-152-3p
  • MIRDB:mmu-miR-152-3p
  • RNA22-MMU:mmu-miR-152-3p
  • TARGETSCAN-VERT:mmu-miR-152

References

1. PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3. PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6. PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
7. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).