![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-99b |
||||||||
Accession | MI0000147 (change log) | |||||||
Symbol | MGI:Mir99b | |||||||
Description | Mus musculus miR-99b stem-loop | |||||||
Gene family | MIPF0000033; mir-10 | |||||||
Literature search |
![]()
54 open access papers mention mmu-mir-99b | |||||||
Stem-loop |
cc ac c c - - c 5' ggcac acccguaga cga cuug g g ggc u ||||| ||||||||| ||| |||| | | ||| 3' cugug ugggugucu gcu gaac c c ccg u cc gu c a a g c |
|||||||
Deep sequencing |
| |||||||
Confidence |
Annotation confidence: high
| |||||||
Comments |
Expression of this miRNA in mouse was independently verified in the brain [1], embryonic stem cells [2] and testes [3]. |
|||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
|
Mature sequence mmu-miR-99b-5p |
|
Accession | MIMAT0000132 |
Previous IDs | mmu-miR-99b |
Sequence |
7 - cacccguagaaccgaccuugcg - 28 |
Deep sequencing | 3489428 reads, 109 experiments |
Evidence | experimental; cloned [1-4], Illumina [5-6] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-99b-3p |
|
Accession | MIMAT0004525 |
Previous IDs | mmu-miR-99b* |
Sequence |
45 - caagcucgugucuguggguccg - 66 |
Deep sequencing | 19240 reads, 96 experiments |
Evidence | experimental; cloned [4], Illumina [5-6] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12007417
"Identification of tissue-specific microRNAs from mouse"
Curr Biol. 12:735-739(2002).
|
2 |
PMID:12919684
"Embryonic stem cell-specific MicroRNAs"
Dev Cell. 5:351-358(2003).
|
3 | |
4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
5 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
6 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|