Stem-loop sequence dme-mir-6-1

Accession MI0000124
Description Drosophila melanogaster miR-6-1 stem-loop
Gene family MIPF0000119; mir-6
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-6_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The mir-6 microRNA precursor is a precursor microRNA specific to Drosophila species. In Drosophila melanogaster there are three mir-6 paralogs called dme-mir-6-1, dme-mir-6-2, dme-mir-6-3, which are clustered together in the genome. The extents of these hairpin precursors are estimated based on hairpin prediction. Each precursor is generated following the cleavage of a longer primary transcript in the nucleus, and is exported in the cytoplasm. In the cytoplasm, precursors are further processed by the enzyme Dicer, generating ~22 nucleotide products from each arm of the hairpin. The products generated from the 3' arm of each mir-6 precursor have identical sequences. Both 5' and 3' mature products are experimentally validated. Experimental data suggests that the mature products of mir-6 hairpins are expressed in the early embryo of Drosophila and target apoptotic genes such as hid, grim and rpr.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
-uuuaaug             ug     c    ag uaau 
        uagagggaauagu  cugug ugua  u    a
        |||||||||||||  ||||| ||||  |    u
        guuuuucuugucg  gacac auau  a    a
aaauccau             gu     u    cu uacc 
Get sequence
Deep sequencing
22569 reads, 32 experiments
Genome context
Coordinates (BDGP5.0) Overlapping transcripts
2R: 15548508-15548589 [-]
intergenic
Clustered miRNAs
< 10kb from dme-mir-6-1
dme-mir-309 2R: 15549211-15549279 [-]
dme-mir-3 2R: 15549100-15549168 [-]
dme-mir-286 2R: 15548927-15549026 [-]
dme-mir-4 2R: 15548794-15548874 [-]
dme-mir-5 2R: 15548663-15548731 [-]
dme-mir-6-1 2R: 15548508-15548589 [-]
dme-mir-6-2 2R: 15548374-15548447 [-]
dme-mir-6-3 2R: 15548221-15548300 [-]
Database links

Mature sequence dme-miR-6-1-5p

Accession MIMAT0020787
Sequence

11 - 

agggaauaguugcugugcugua

 - 32

Get sequence
Deep sequencing 10291 reads, 22 experiments
Evidence not experimental
Predicted targets

Mature sequence dme-miR-6-3p

Accession MIMAT0000111
Previous IDs dme-miR-6
Sequence

52 - 

uaucacaguggcuguucuuuuu

 - 73

Get sequence
Deep sequencing 36746 reads, 27 experiments
Evidence experimental; cloned [1,3], Northern [1-2], 454 [4], Solexa [5]
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
3
PMID:12919683 "The small RNA profile during Drosophila melanogaster development" Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T Dev Cell. 5:337-350(2003).
4
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).
5
PMID:17989255 "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M Genome Res. 17:1865-1879(2007).