Stem-loop sequence hsa-mir-24-1

Accession MI0000080
Symbol HGNC:MIR24-1
Description Homo sapiens miR-24-1 stem-loop
Gene family MIPF0000041; mir-24
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-24_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-24 microRNA precursor is a small non-coding RNA molecule that regulates gene expression. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a mature ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. miR-24 is conserved in various species, and is clustered with miR-23 and miR-27, on human chromosome 9 and 19. Recently, miR-24 has been shown to suppress expression of two crucial cell cycle control genes, E2F2 and Myc in hematopoietic differentiation and also to promote keratinocyte differentiation by repressing actin-cytoskeleton regulators PAK4, Tsk5 and ArhGAP19.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
    g  g   a         ua     ucuca 
cucc gu ccu cugagcuga  ucagu     u
|||| || ||| |||||||||  |||||     u
gagg ca gga gacuugacu  gguca     u
    a  a   c         -c     cacau 
Get sequence
Deep sequencing
69885 reads, 52 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr9: 97848303-97848370 [+]
sense
OTTHUMT00000053202 ; C9orf3-007; intron 4
OTTHUMT00000053202 ; C9orf3-007; intron 4
OTTHUMT00000053202 ; C9orf3-007; intron 4
OTTHUMT00000053196 ; C9orf3-001; intron 5
OTTHUMT00000053209 ; C9orf3-014; intron 5
OTTHUMT00000053196 ; C9orf3-001; intron 5
OTTHUMT00000053209 ; C9orf3-014; intron 5
OTTHUMT00000053196 ; C9orf3-001; intron 5
OTTHUMT00000053209 ; C9orf3-014; intron 5
OTTHUMT00000053211 ; C9orf3-016; exon 7
OTTHUMT00000053211 ; C9orf3-016; exon 7
OTTHUMT00000053211 ; C9orf3-016; exon 7
OTTHUMT00000053197 ; C9orf3-002; intron 14
OTTHUMT00000053197 ; C9orf3-002; intron 14
OTTHUMT00000053197 ; C9orf3-002; intron 14
OTTHUMT00000053203 ; C9orf3-008; intron 15
OTTHUMT00000053203 ; C9orf3-008; intron 15
OTTHUMT00000053203 ; C9orf3-008; intron 15
ENST00000468164 ; C9orf3-007; intron 4
ENST00000468164 ; C9orf3-007; intron 4
ENST00000468164 ; C9orf3-007; intron 4
ENST00000471978 ; C9orf3-014; intron 5
ENST00000463372 ; C9orf3-001; intron 5
ENST00000471978 ; C9orf3-014; intron 5
ENST00000463372 ; C9orf3-001; intron 5
ENST00000471978 ; C9orf3-014; intron 5
ENST00000463372 ; C9orf3-001; intron 5
ENST00000375314 ; C9orf3-201; intron 6
ENST00000375314 ; C9orf3-201; intron 6
ENST00000478473 ; C9orf3-016; exon 7
ENST00000478473 ; C9orf3-016; exon 7
ENST00000478473 ; C9orf3-016; exon 7
ENST00000297979 ; C9orf3-002; intron 14
ENST00000297979 ; C9orf3-002; intron 14
ENST00000297979 ; C9orf3-002; intron 14
ENST00000428313 ; C9orf3-008; intron 15
ENST00000375315 ; C9orf3-202; intron 15
ENST00000428313 ; C9orf3-008; intron 15
ENST00000375315 ; C9orf3-202; intron 15
ENST00000428313 ; C9orf3-008; intron 15
ENST00000375315 ; C9orf3-201; intron 15
antisense
ENST00000384885 ; MIR24-1-201; exon 1
Clustered miRNAs
< 10kb from hsa-mir-24-1
hsa-mir-23b chr9: 97847490-97847586 [+]
hsa-mir-27b chr9: 97847727-97847823 [+]
hsa-mir-3074 chr9: 97848296-97848376 [-]
hsa-mir-24-1 chr9: 97848303-97848370 [+]
Database links

Mature sequence hsa-miR-24-1-5p

Accession MIMAT0000079
Previous IDs hsa-miR-189;hsa-miR-24-1*
Sequence

7 - 

ugccuacugagcugauaucagu

 - 28

Get sequence
Deep sequencing 155 reads, 13 experiments
Evidence experimental; cloned [7]
Validated targets
Predicted targets

Mature sequence hsa-miR-24-3p

Accession MIMAT0000080
Previous IDs hsa-miR-24
Sequence

44 - 

uggcucaguucagcaggaacag

 - 65

Get sequence
Deep sequencing 139200 reads, 52 experiments
Evidence experimental; cloned [1,4,6-8], Northern [1], Solexa [9]
Validated targets
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
3
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
4
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
5
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
6
PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
7
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
8
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
9