Stem-loop sequence mdo-mir-7373f

AccessionMI0040980 (change log)
DescriptionMonodelphis domestica miR-7373f stem-loop
Stem-loop
   ---         u    a  a     auguugc 
5'    aagcccuuu auua ug uugag       g
      ||||||||| |||| || |||||        
3'    uuugggaaa uaau ac gacuc       a
   uua         -    c  g     cuuuuau 
Get sequence
Deep sequencing
1423 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 44688086-44688149 [-]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-7373f
mdo-mir-7373dchrX: 44689543-44689601 [-]
mdo-mir-7373cchrX: 44688608-44688663 [-]
mdo-mir-7373fchrX: 44688086-44688149 [-]
mdo-mir-7373bchrX: 44687808-44687862 [-]
mdo-mir-7374dchrX: 44686439-44686494 [-]
mdo-mir-7374bchrX: 44682076-44682130 [-]
mdo-mir-7374cchrX: 44681360-44681416 [-]
mdo-mir-7375c-2chrX: 44679658-44679714 [-]
Database links

Mature sequence mdo-miR-7373f-5p

Accession MIMAT0050436
Sequence

1 - 

aagcccuuuuauuaaugauugag

 - 23

Get sequence
Deep sequencing155 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence mdo-miR-7373f-3p

Accession MIMAT0050437
Sequence

42 - 

caggcacuaauaaaggguuuau

 - 63

Get sequence
Deep sequencing1268 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:29079676 "Sex-biased microRNA expression in mammals and birds reveals underlying regulatory mechanisms and a role in dosage compensation" Warnefors M, Mossinger K, Halbert J, Studer T, VandeBerg JL, Lindgren I, Fallahshahroudi A, Jensen P, Kaessmann H Genome Res. [Epub prior to print](2017).