Stem-loop sequence mdo-mir-7374d

AccessionMI0040979 (change log)
DescriptionMonodelphis domestica miR-7374d stem-loop
Stem-loop
   --a       a  ca    g    u  a 
5'    agcccuu cc  ucua cuga ga u
      ||||||| ||  |||| |||| || g
3'    uugggga gg  agau gacu cu u
   ucg       a  ag    g    -  u 
Get sequence
Deep sequencing
532 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 44686439-44686494 [-]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-7374d
mdo-mir-7373dchrX: 44689543-44689601 [-]
mdo-mir-7373cchrX: 44688608-44688663 [-]
mdo-mir-7373fchrX: 44688086-44688149 [-]
mdo-mir-7373bchrX: 44687808-44687862 [-]
mdo-mir-7374dchrX: 44686439-44686494 [-]
mdo-mir-7374bchrX: 44682076-44682130 [-]
mdo-mir-7374cchrX: 44681360-44681416 [-]
mdo-mir-7375c-2chrX: 44679658-44679714 [-]
mdo-mir-7375dchrX: 44676822-44676879 [-]
mdo-mir-7375chrX: 44676538-44676594 [-]
Database links

Mature sequence mdo-miR-7374d-5p

Accession MIMAT0050434
Sequence

1 - 

aagcccuuacccaucuagcuga

 - 22

Get sequence
Deep sequencing516 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence mdo-miR-7374d-3p

Accession MIMAT0050435
Sequence

35 - 

agguagagaggaagggguugc

 - 55

Get sequence
Deep sequencing16 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:29079676 "Sex-biased microRNA expression in mammals and birds reveals underlying regulatory mechanisms and a role in dosage compensation" Warnefors M, Mossinger K, Halbert J, Studer T, VandeBerg JL, Lindgren I, Fallahshahroudi A, Jensen P, Kaessmann H Genome Res. [Epub prior to print](2017).