Stem-loop sequence mdo-mir-7375c-4

AccessionMI0040973 (change log)
DescriptionMonodelphis domestica miR-7375c-4 stem-loop
Stem-loop
   ---------------------ua   c  a    -   -   u  uagu 
5'                        gcc uu cccc ccc aac ag    a
                          ||| || |||| ||| ||| ||     
3'                        cgg aa gggg ggg uug uc    u
   cacgacacucuacuuccucguua   a  -    a   a   -  uaau 
Get sequence
Deep sequencing
3897 reads, 20 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 44674236-44674310 [-]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-7375c-4
mdo-mir-7374bchrX: 44682076-44682130 [-]
mdo-mir-7374cchrX: 44681360-44681416 [-]
mdo-mir-7375c-2chrX: 44679658-44679714 [-]
mdo-mir-7375dchrX: 44676822-44676879 [-]
mdo-mir-7375chrX: 44676538-44676594 [-]
mdo-mir-7375echrX: 44675952-44676008 [-]
mdo-mir-7375c-3chrX: 44674818-44674874 [-]
mdo-mir-7375c-1chrX: 44674536-44674592 [-]
mdo-mir-7375c-4chrX: 44674236-44674310 [-]
mdo-mir-7374achrX: 44670461-44670515 [-]
mdo-mir-12403chrX: 44668666-44668723 [-]
mdo-mir-7373echrX: 44667557-44667611 [-]
mdo-mir-7373a-2chrX: 44666176-44666233 [-]
mdo-mir-7373a-1chrX: 44665891-44665948 [-]
Database links

Mature sequence mdo-miR-7375c-4-5p

Accession MIMAT0050427
Sequence

1 - 

uagcccuuacccccccaacuag

 - 22

Get sequence
Deep sequencing2303 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence mdo-miR-7375c-3p

Accession MIMAT0050428
Sequence

34 - 

uguuagggaggggaaaggcauugc

 - 57

Get sequence
Deep sequencing6071 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:29079676 "Sex-biased microRNA expression in mammals and birds reveals underlying regulatory mechanisms and a role in dosage compensation" Warnefors M, Mossinger K, Halbert J, Studer T, VandeBerg JL, Lindgren I, Fallahshahroudi A, Jensen P, Kaessmann H Genome Res. [Epub prior to print](2017).