Stem-loop sequence mdo-mir-210b

AccessionMI0040936 (change log)
DescriptionMonodelphis domestica miR-210b stem-loop
Stem-loop
   -u        u ac       g  g  c 
5'   agccgcug c  acgcaca ug gu c
     |||||||| |  ||||||| || || u
3'   ucggugac g  ugcgugu ac cg g
   cc        u au       a  g  a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
NW_001584700.1: 16429-16486 [-]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-210b
mdo-mir-210bNW_001584700.1: 16429-16486 [-]
mdo-mir-210NW_001584700.1: 16418-16499 [+]
Database links

Mature sequence mdo-miR-210b-5p

Accession MIMAT0050366
Sequence

1 - 

uagccgcugucacacgcacagu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mdo-miR-210b-3p

Accession MIMAT0050367
Sequence

37 - 

augugcguuagucaguggcuc

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:29079676 "Sex-biased microRNA expression in mammals and birds reveals underlying regulatory mechanisms and a role in dosage compensation" Warnefors M, Mossinger K, Halbert J, Studer T, VandeBerg JL, Lindgren I, Fallahshahroudi A, Jensen P, Kaessmann H Genome Res. [Epub prior to print](2017).