Stem-loop sequence gga-mir-122b-2

AccessionMI0040778 (change log)
DescriptionGallus gallus miR-122b-2 stem-loop
Literature search

16 open access papers mention gga-mir-122b-2
(83 sentences)

Stem-loop
   --uuu             c     auaga 
5'      agugugauaaugg guuug     u
        ||||||||||||| |||||      
3'      ucacacuguuacc caaac     u
   auacc             a     acagg 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
KQ759512.1: 11822-11879 [-]
intergenic
Clustered miRNAs
< 10kb from gga-mir-122b-2
gga-mir-122b-2KQ759512.1: 11822-11879 [-]
gga-mir-122-2KQ759512.1: 11816-11892 [+]
Database links

Mature sequence gga-miR-122b-5p

Accession MIMAT0050092
Sequence

1 - 

uuuagugugauaauggcguuug

 - 22

Get sequence
Deep sequencing10 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence gga-miR-122b-3p

Accession MIMAT0050093
Sequence

36 - 

aaacaccauugucacacucca

 - 56

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:29079676 "Sex-biased microRNA expression in mammals and birds reveals underlying regulatory mechanisms and a role in dosage compensation" Warnefors M, Mossinger K, Halbert J, Studer T, VandeBerg JL, Lindgren I, Fallahshahroudi A, Jensen P, Kaessmann H Genome Res. [Epub prior to print](2017).