Stem-loop sequence gga-mir-9b-2

AccessionMI0040777 (change log)
DescriptionGallus gallus miR-9b-2 stem-loop
Literature search

19 open access papers mention gga-mir-9b-2
(326 sentences)

Stem-loop
   -uuc            u     agacc 
5'     gguuaucuagcu uauga     a
       |||||||||||| |||||      
3'     ccaauagaucga auacu     a
   gaaa            c     cacaa 
Get sequence
Deep sequencing
3726 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chrZ: 60469258-60469312 [-]
intergenic
Clustered miRNAs
< 10kb from gga-mir-9b-2
gga-mir-9b-2chrZ: 60469258-60469312 [-]
gga-mir-9-2chrZ: 60469242-60469328 [+]
Database links

Mature sequence gga-miR-9b-5p

Accession MIMAT0049903
Sequence

1 - 

uucgguuaucuagcuuuauga

 - 21

Get sequence
Deep sequencing7398 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence gga-miR-9b-3p

Accession MIMAT0049904
Sequence

36 - 

auacagcuagauaaccaaag

 - 55

Get sequence
Deep sequencing122 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:29079676 "Sex-biased microRNA expression in mammals and birds reveals underlying regulatory mechanisms and a role in dosage compensation" Warnefors M, Mossinger K, Halbert J, Studer T, VandeBerg JL, Lindgren I, Fallahshahroudi A, Jensen P, Kaessmann H Genome Res. [Epub prior to print](2017).