Stem-loop sequence gga-let-7l-2

AccessionMI0040769 (change log)
DescriptionGallus gallus let-7l-2 stem-loop
Literature search

45 open access papers mention gga-let-7l-2
(220 sentences)

Stem-loop
   --u                      ggggggccgggaugg 
5'    gagguagucgguuguauuguug               g
      ||||||||||||||||||||||               g
3'    uuucaucagccgacguagcaau               g
   ccc                      ggagcucacaccccc 
Get sequence
Deep sequencing
6521819 reads, 7.69e+04 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
AADN04020204.1: 2008-2088 [-]
intergenic
Database links

Mature sequence gga-let-7l-5p

Accession MIMAT0050080
Sequence

1 - 

ugagguagucgguuguauuguu

 - 22

Get sequence
Deep sequencing13043546 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence gga-let-7l-3p

Accession MIMAT0050081
Sequence

60 - 

cgaugcagccgacuacuuucc

 - 80

Get sequence
Deep sequencing90 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:29079676 "Sex-biased microRNA expression in mammals and birds reveals underlying regulatory mechanisms and a role in dosage compensation" Warnefors M, Mossinger K, Halbert J, Studer T, VandeBerg JL, Lindgren I, Fallahshahroudi A, Jensen P, Kaessmann H Genome Res. [Epub prior to print](2017).