Stem-loop sequence gga-let-7l-1

AccessionMI0040762 (change log)
DescriptionGallus gallus let-7l-1 stem-loop
Literature search

45 open access papers mention gga-let-7l-1
(220 sentences)

Stem-loop
   --u                      ----------      gg 
5'    gagguagucgguuguauuguug          ggggcc  g
      ||||||||||||||||||||||          ||||||  a
3'    uuucaucagccgacguagcaau          ccccgg  u
   ccc                      ggagcucaca      gg 
Get sequence
Deep sequencing
6521819 reads, 7.69e+04 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
AADN04005513.1: 10244-10320 [-]
intergenic
Database links

Mature sequence gga-let-7l-5p

Accession MIMAT0050080
Sequence

1 - 

ugagguagucgguuguauuguu

 - 22

Get sequence
Deep sequencing13043546 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence gga-let-7l-3p

Accession MIMAT0050081
Sequence

56 - 

cgaugcagccgacuacuuucc

 - 76

Get sequence
Deep sequencing90 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:29079676 "Sex-biased microRNA expression in mammals and birds reveals underlying regulatory mechanisms and a role in dosage compensation" Warnefors M, Mossinger K, Halbert J, Studer T, VandeBerg JL, Lindgren I, Fallahshahroudi A, Jensen P, Kaessmann H Genome Res. [Epub prior to print](2017).