Stem-loop sequence gga-mir-10c

AccessionMI0040732 (change log)
DescriptionGallus gallus miR-10c stem-loop
Literature search

7 open access papers mention gga-mir-10c
(14 sentences)

Stem-loop
   -uac   g    cu          ugag  u 
5'     ccu uaga  cgaauuugug    cg c
       ||| ||||  ||||||||||    ||  
3'     ggg aucu  gcuuaaacgc    gc u
   auaa   g    cu          -uga  c 
Get sequence
Deep sequencing
18839 reads, 280 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr33: 1093263-1093324 [+]
intergenic
Database links

Mature sequence gga-miR-10c-5p

Accession MIMAT0050024
Sequence

1 - 

uacccuguagacucgaauuugu

 - 22

Get sequence
Deep sequencing15297 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence gga-miR-10c-3p

Accession MIMAT0050025
Sequence

41 - 

caaauucgucucuaggggaau

 - 61

Get sequence
Deep sequencing3542 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:29079676 "Sex-biased microRNA expression in mammals and birds reveals underlying regulatory mechanisms and a role in dosage compensation" Warnefors M, Mossinger K, Halbert J, Studer T, VandeBerg JL, Lindgren I, Fallahshahroudi A, Jensen P, Kaessmann H Genome Res. [Epub prior to print](2017).