Stem-loop sequence gga-mir-205c

AccessionMI0040717 (change log)
DescriptionGallus gallus miR-205c stem-loop
Literature search

2 open access papers mention gga-mir-205c
(2 sentences)

Stem-loop
   ---g     c       aaa    guuag 
5'     cuuca uccacug   ucug     g
       ||||| |||||||   ||||     u
3'     gaagu agguggc   agac     a
   acag     a       cuc    agagc 
Get sequence
Deep sequencing
128 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr26: 3076089-3076146 [-]
intergenic
Clustered miRNAs
< 10kb from gga-mir-205c
gga-mir-205cchr26: 3076089-3076146 [-]
gga-mir-205achr26: 3076070-3076165 [+]
Database links

Mature sequence gga-miR-205c-5p

Accession MIMAT0049995
Sequence

1 - 

gcuucacuccacugaaaucugg

 - 22

Get sequence
Deep sequencing12 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence gga-miR-205c-3p

Accession MIMAT0049996
Sequence

37 - 

gacuccgguggaaugaagga

 - 56

Get sequence
Deep sequencing116 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:29079676 "Sex-biased microRNA expression in mammals and birds reveals underlying regulatory mechanisms and a role in dosage compensation" Warnefors M, Mossinger K, Halbert J, Studer T, VandeBerg JL, Lindgren I, Fallahshahroudi A, Jensen P, Kaessmann H Genome Res. [Epub prior to print](2017).