Stem-loop sequence gga-mir-12248

AccessionMI0040712 (change log)
DescriptionGallus gallus miR-12248 stem-loop
Stem-loop
   --uc     auu     uca      gaa 
5'     agccc   ugucc   ugccug   c
       |||||   |||||   ||||||    
3'     ucggg   acagg   auggac   u
   gguu     ggu     --c      gug 
Get sequence
Deep sequencing
4 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr23: 4355778-4355833 [+]
intergenic
Clustered miRNAs
< 10kb from gga-mir-12248
gga-mir-12248chr23: 4355778-4355833 [+]
gga-mir-1bchr23: 4357025-4357088 [+]
gga-mir-133cchr23: 4357164-4357242 [+]
Database links

Mature sequence gga-miR-12248-5p

Accession MIMAT0049985
Sequence

1 - 

ucagcccauuuguccucaugccu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence gga-miR-12248-3p

Accession MIMAT0049986
Sequence

35 - 

gguacggacaugggggcuuugg

 - 56

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:29079676 "Sex-biased microRNA expression in mammals and birds reveals underlying regulatory mechanisms and a role in dosage compensation" Warnefors M, Mossinger K, Halbert J, Studer T, VandeBerg JL, Lindgren I, Fallahshahroudi A, Jensen P, Kaessmann H Genome Res. [Epub prior to print](2017).