Stem-loop sequence gga-mir-425

AccessionMI0040676 (change log)
DescriptionGallus gallus miR-425 stem-loop
Literature search

2 open access papers mention gga-mir-425
(2 sentences)

Stem-loop
   --aau       u  cu    c  a  g gca 
5'      gacacga ca  cccg ug gc c   g
        ||||||| ||  |||| || || |   c
3'      cugugcu gu  gggc ac cg g   c
   ccugu       -  ag    u  -  a aca 
Get sequence
Deep sequencing
128929 reads, 1.3e+03 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr12: 11671363-11671425 [+]
intergenic
Clustered miRNAs
< 10kb from gga-mir-425
gga-mir-191chr12: 11670979-11671038 [+]
gga-mir-425chr12: 11671363-11671425 [+]
Database links

Mature sequence gga-miR-425-5p

Accession MIMAT0049919
Sequence

1 - 

aaugacacgaucacucccgcuga

 - 23

Get sequence
Deep sequencing113822 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence gga-miR-425-3p

Accession MIMAT0049920
Sequence

41 - 

caucggggaugucgugucuguc

 - 62

Get sequence
Deep sequencing15107 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:29079676 "Sex-biased microRNA expression in mammals and birds reveals underlying regulatory mechanisms and a role in dosage compensation" Warnefors M, Mossinger K, Halbert J, Studer T, VandeBerg JL, Lindgren I, Fallahshahroudi A, Jensen P, Kaessmann H Genome Res. [Epub prior to print](2017).