Stem-loop sequence gga-mir-191

AccessionMI0040675 (change log)
DescriptionGallus gallus miR-191 stem-loop
Literature search

3 open access papers mention gga-mir-191
(3 sentences)

Stem-loop
   --c            aaa       uc cc 
5'    aacggaauccca   gcagcug  c  g
      ||||||||||||   |||||||  |  c
3'    uugcuuuagggu   cgucgac  g  a
   cca            -cc       cc cg 
Get sequence
Deep sequencing
178254 reads, 1.94e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr12: 11670979-11671038 [+]
intergenic
Clustered miRNAs
< 10kb from gga-mir-191
gga-mir-191chr12: 11670979-11671038 [+]
gga-mir-425chr12: 11671363-11671425 [+]
Database links

Mature sequence gga-miR-191-5p

Accession MIMAT0049917
Sequence

1 - 

caacggaaucccaaaagcagcug

 - 23

Get sequence
Deep sequencing176596 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence gga-miR-191-3p

Accession MIMAT0049918
Sequence

40 - 

cugcccugggauuucguuacc

 - 60

Get sequence
Deep sequencing1657 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:29079676 "Sex-biased microRNA expression in mammals and birds reveals underlying regulatory mechanisms and a role in dosage compensation" Warnefors M, Mossinger K, Halbert J, Studer T, VandeBerg JL, Lindgren I, Fallahshahroudi A, Jensen P, Kaessmann H Genome Res. [Epub prior to print](2017).