Stem-loop sequence mmu-mir-3473h

AccessionMI0040641 (change log)
DescriptionMus musculus miR-3473h stem-loop
Literature search

3 open access papers mention mmu-mir-3473h
(69 sentences)

Stem-loop
   --     --g      ag  gac      g u 
5'   uaggg   cuggaa  gu   ucagug u a
     |||||   ||||||  ||   |||||| |  
3'   guccu   gaccuu  cg   agucac a a
   ga     gga      cu  -uc      g g 
Get sequence
Deep sequencing
7089 reads, 1.82e+03 reads per million, 151 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr3: 116667557-116667617 [-]
intergenic
Database links

Mature sequence mmu-miR-3473h-5p

Accession MIMAT0049861
Sequence

1 - 

uaggggcuggaaaggugacu

 - 20

Get sequence
Deep sequencing1342 reads, 55 experiments
Evidence experimental; Illumina [1]

References

1
PMID:29079676 "Sex-biased microRNA expression in mammals and birds reveals underlying regulatory mechanisms and a role in dosage compensation" Warnefors M, Mossinger K, Halbert J, Studer T, VandeBerg JL, Lindgren I, Fallahshahroudi A, Jensen P, Kaessmann H Genome Res. [Epub prior to print](2017).