Stem-loop sequence mmu-mir-124b

AccessionMI0040637 (change log)
DescriptionMus musculus miR-124b stem-loop
Literature search

225 open access papers mention mmu-mir-124b
(2502 sentences)

Stem-loop
   --gca     c   ug    a   guau 
5'      uucac gcg  ccuu auu    g
        ||||| |||  |||| |||    a
3'      aagug cgc  ggaa uaa    c
   ggcac     u   cu    c   auua 
Get sequence
Deep sequencing
161 reads, 0 reads per million, 29 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr3: 17795685-17795741 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-124b
mmu-mir-124bchr3: 17795685-17795741 [-]
mmu-mir-124-2chr3: 17795662-17795770 [+]
Database links

Mature sequence mmu-miR-124b-3p

Accession MIMAT0049857
Sequence

36 - 

ucaagguccgcugugaacacgg

 - 57

Get sequence
Deep sequencing160 reads, 28 experiments
Evidence experimental; Illumina [1]

References

1
PMID:29079676 "Sex-biased microRNA expression in mammals and birds reveals underlying regulatory mechanisms and a role in dosage compensation" Warnefors M, Mossinger K, Halbert J, Studer T, VandeBerg JL, Lindgren I, Fallahshahroudi A, Jensen P, Kaessmann H Genome Res. [Epub prior to print](2017).