![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-3083b |
||||||
Accession | MI0040630 (change log) | |||||
Description | Mus musculus miR-3083b stem-loop | |||||
Stem-loop |
- c 5' aaggcugggaauguuucggagauaua a |||||||||||||||||||||||||| 3' uuccgacccuuauaaagucucuauau u u a |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: not enough data
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence mmu-miR-3083b-5p |
|
Accession | MIMAT0049846 |
Sequence |
1 - aaggcugggaauguuucggaga - 22 |
Deep sequencing | 709 reads, 22 experiments |
Evidence | experimental; Illumina [1] |
Mature sequence mmu-miR-3083b-3p |
|
Accession | MIMAT0049847 |
Sequence |
35 - ucucugaaauauucccagccuu - 56 |
Deep sequencing | 10 reads, 4 experiments |
Evidence | experimental; Illumina [1] |
References |
|
1 |
PMID:29079676
"Sex-biased microRNA expression in mammals and birds reveals underlying regulatory mechanisms and a role in dosage compensation"
Genome Res. [Epub prior to print](2017).
|