Stem-loop sequence mmu-mir-3083b

AccessionMI0040630 (change log)
DescriptionMus musculus miR-3083b stem-loop
Stem-loop
   -                          c 
5'  aaggcugggaauguuucggagauaua a
    ||||||||||||||||||||||||||  
3'  uuccgacccuuauaaagucucuauau u
   u                          a 
Get sequence
Deep sequencing
719 reads, 0 reads per million, 23 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr17: 26948060-26948116 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-3083b
mmu-mir-3083chr17: 26948056-26948119 [-]
mmu-mir-3083bchr17: 26948060-26948116 [+]
Database links

Mature sequence mmu-miR-3083b-5p

Accession MIMAT0049846
Sequence

1 - 

aaggcugggaauguuucggaga

 - 22

Get sequence
Deep sequencing709 reads, 22 experiments
Evidence experimental; Illumina [1]

Mature sequence mmu-miR-3083b-3p

Accession MIMAT0049847
Sequence

35 - 

ucucugaaauauucccagccuu

 - 56

Get sequence
Deep sequencing10 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:29079676 "Sex-biased microRNA expression in mammals and birds reveals underlying regulatory mechanisms and a role in dosage compensation" Warnefors M, Mossinger K, Halbert J, Studer T, VandeBerg JL, Lindgren I, Fallahshahroudi A, Jensen P, Kaessmann H Genome Res. [Epub prior to print](2017).