Stem-loop sequence mmu-mir-9b-2

AccessionMI0040624 (change log)
DescriptionMus musculus miR-9b-2 stem-loop
Literature search

208 open access papers mention mmu-mir-9b-2
(1070 sentences)

Stem-loop
   --uuc            u     agacc 
5'      gguuaucuagcu uauga     a
        |||||||||||| |||||      
3'      ccaauagaucga auacu     a
   agaaa            c     cacau 
Get sequence
Deep sequencing
3544 reads, 24 reads per million, 25 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr13: 83738821-83738876 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-9b-2
mmu-mir-9b-2chr13: 83738821-83738876 [-]
mmu-mir-9-2chr13: 83738814-83738885 [+]
Database links

Mature sequence mmu-miR-9b-5p

Accession MIMAT0049835
Sequence

1 - 

uucgguuaucuagcuuuauga

 - 21

Get sequence
Deep sequencing8374 reads, 22 experiments
Evidence experimental; Illumina [1]

Mature sequence mmu-miR-9b-3p

Accession MIMAT0049836
Sequence

36 - 

auacagcuagauaaccaaaga

 - 56

Get sequence
Deep sequencing2175 reads, 20 experiments
Evidence experimental; Illumina [1]

References

1
PMID:29079676 "Sex-biased microRNA expression in mammals and birds reveals underlying regulatory mechanisms and a role in dosage compensation" Warnefors M, Mossinger K, Halbert J, Studer T, VandeBerg JL, Lindgren I, Fallahshahroudi A, Jensen P, Kaessmann H Genome Res. [Epub prior to print](2017).