Stem-loop sequence mmu-mir-203b

AccessionMI0040622 (change log)
DescriptionMus musculus miR-203b stem-loop
Literature search

2 open access papers mention mmu-mir-203b
(2 sentences)

Stem-loop
   --      c  aa   u    -  a  g    
5'   aguggu cu  aca uuca ca uu ugc 
     |||||| ||  ||| |||| || || || u
3'   ucacca ga  ugu aagu gu aa aca 
   gg      a  ac   c    u  c  g    
Get sequence
Deep sequencing
2252 reads, 2.38 reads per million, 42 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 112130887-112130946 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-203b
mmu-mir-203bchr12: 112130887-112130946 [-]
mmu-mir-203chr12: 112130880-112130955 [+]
Database links

Mature sequence mmu-miR-203b-5p

Accession MIMAT0049831
Sequence

1 - 

agugguccuaaacauuucac

 - 20

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mmu-miR-203b-3p

Accession MIMAT0049832
Sequence

39 - 

uugaacugucaagaaccacugg

 - 60

Get sequence
Deep sequencing2252 reads, 42 experiments
Evidence experimental; Illumina [1]

References

1
PMID:29079676 "Sex-biased microRNA expression in mammals and birds reveals underlying regulatory mechanisms and a role in dosage compensation" Warnefors M, Mossinger K, Halbert J, Studer T, VandeBerg JL, Lindgren I, Fallahshahroudi A, Jensen P, Kaessmann H Genome Res. [Epub prior to print](2017).