Stem-loop sequence aof-MIR396b

AccessionMI0040598 (change log)
DescriptionAsparagus officinalis miR396b stem-loop
Literature search

1 open access papers mention aof-MIR396b
(5 sentences)

Stem-loop
   --u   uaaa    -          u              c          -uagaaaa  g    aa 
5'    uca    uggu ucucuuugua uuuuccacagcuuu uugaacugca        gg cuuc  u
      |||    |||| |||||||||| |||||||||||||| ||||||||||        || ||||  u
3'    agu    auca agggagacau aaagggugucgaaa aacuuggcgu        uc gaag  g
   gcc   -uaa    g          u              u          uuuaaccg  g    cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Aspof.V1; GCA_001876935.1) Overlapping transcripts
chr5: 125132617-125132750 [+]
intergenic
Database links

Mature sequence aof-miR396b

Accession MIMAT0049804
Sequence

26 - 

uuccacagcuuucuugaacug

 - 46

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:29093472 "The asparagus genome sheds light on the origin and evolution of a young Y chromosome" Harkess A, Zhou J, Xu C, Bowers JE, Van der Hulst R, Ayyampalayam S, Mercati F, Riccardi P, McKain MR, Kakrana A, Tang H, Ray J, Groenendijk J, Arikit S, Mathioni SM, Nakano M, Shan H, Telgmann-Rauber A, Kanno A, Yue Z, Chen H, Li W, Chen Y, Xu X, Zhang Y Nat Commun. 8:1279(2017).