Stem-loop sequence aof-MIR396a

AccessionMI0040597 (change log)
DescriptionAsparagus officinalis miR396a stem-loop
Literature search

1 open access papers mention aof-MIR396a
(7 sentences)

Stem-loop
   --g  a u     --u    ga      c       g               u   caa     auu       auuuuucucuuuuugaauaguuuggaaaaagaaaaaaaaau 
5'    ga g caaga   uaug  uauguu uuccacg cuuucuugaacugug acu   uucuu   ucuuuuc                                         a
      || | |||||   ||||  |||||| ||||||| ||||||||||||||| |||   |||||   |||||||                                         g
3'    cu c guuuu   guac  guacaa agggugc gaaagaacuugauac ugg   aagag   agaaaag                                         g
   cug  - u     ucu    -g      a       a               -   ---     -gu       gguuuaauaagaaaagaaaaaaggcaguaggaaaaaaaaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Aspof.V1; GCA_001876935.1) Overlapping transcripts
chr10: 6303127-6303348 [+]
intergenic
Database links

Mature sequence aof-miR396a

Accession MIMAT0049803
Sequence

26 - 

uuccacggcuuucuugaacug

 - 46

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:29093472 "The asparagus genome sheds light on the origin and evolution of a young Y chromosome" Harkess A, Zhou J, Xu C, Bowers JE, Van der Hulst R, Ayyampalayam S, Mercati F, Riccardi P, McKain MR, Kakrana A, Tang H, Ray J, Groenendijk J, Arikit S, Mathioni SM, Nakano M, Shan H, Telgmann-Rauber A, Kanno A, Yue Z, Chen H, Li W, Chen Y, Xu X, Zhang Y Nat Commun. 8:1279(2017).