Stem-loop sequence ggo-mir-301a

AccessionMI0039823 (change log)
DescriptionGorilla gorilla miR-301a stem-loop
Literature search

1 open access papers mention ggo-mir-301a
(1 sentences)

Stem-loop
   --uc    ---u          ----a       
5'     ugac    uuauugcacu     cuguac 
       ||||    ||||||||||     ||||| u
3'     acug    gauaacguga     gacauu 
   cgaa    uuau          cgauc       
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr5: 24190668-24190725 [+]
intergenic
Database links

Mature sequence ggo-miR-301a

Accession MIMAT0049111
Sequence

36 - 

cagugcaauaguauugucaaagc

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:28640911 "Evolution of microRNA in primates" McCreight JC, Schneider SE, Wilburn DB, Swanson WJ PLoS One. 12:e0176596(2017).